4. Draw the number of fragments as well as their sizes as they would migrate on theelectrophoresis gel. Write the size of the fragments on the square when you draw them.LadderSal IHae IIEco R1bp50,00024,00020,00016,00010,0009,0008,0007,0006,0005,0004,0003,0002,0001,000DNA migration

Sal1 is a restriction endonuclease i.e it cleaves DNA at the recognition sequence 5'-G/TCGAC-3'…

Answered: 4. Draw the number of fragments as well…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

9. Five DNA samples are shown along with their recognition sites where a particular restriction enzyme would cut them. The fragments for sample “A" have been illustrated on the gel. On the gel, draw where the fragments for samples B, C, D, and E would be found. D. D 0O A. B. MII E DI 000 ANI sd no be A C D E Sinhque s 2olqmse Juode bulonoo uoy no led W.r Table 2 yaled 10. If a restriction enzyme cuts DNA at two recognition sequences, how many fragments will the DNA be cut into? a was AN idoalo too W ||
View History Bookmarks Window Help 1)) 52% I blackboard.azwestern.edu Condensatio nosome imLU Dan Douies dunng Embryonic development of females 1. Semiconservative A nucleic acid monomer consisting of a five-carbon sugar, phosphate group J. Topoisomerase and one of four nitrogen containing bases K. DNA helicase A How DNA replicates, new strand will be complementary to the parent stran L. Primase The enzyme that is responsible for unwinding or overwinding of DNA during replication M. DNA polymerase II A Enzyme in DNA replication that breaks hydrogen bonds of the DNA strand N. DNA polymerase II A Enyzme in DNA replication that synthesizes the RNA primer that is needed for O. DNA polymerase I DNA polymeras to start synthesis P. DNA ligase A Enzyme in DNA replication that is responsible for adding nucleotides in the 5' to 3' direction Q. Telomeres A Enzyme in DNA replication that repairs mismatched nucleotides in DNA replication R. Telomerase S. Mismatch repair A Enzyme in DNA replication…
ment Lopez Chun 1 1006 is Diego 5. For the following DNA strand, complete the following: a. Write the complementary DNA strand below the strand. 5'-A CCTA CGTTC GACGTA ACCGCAT T-3' 3-T6G AT GCAAG CTGCATT GG C6TAA_5² b. Replicate the DNA strand (remember semiconservative replication). 5'-AC CTA CGTTCGAC GTAA CCGCATT-3' 3'- 5'- 3'- 5'-ACCGTTCGACGTAACCGCATT-3' - 5' 138 DNA and BLAST Lab Report - 3' - 5' OLD NEW NEW OLD c. Transcribe the 5' to 3'DNA to an mRNA strand (remember there is NO thymine in RNA). 5'-A CCTA CGTTCGACGTA ACCG CATT-3' DNA mRNA d. Take mRNA strand and convert to amino acid (protein) using mRNA codon table (Table 4). Remember mRNA is read 5' to 3' so you will need to re-write the sequence to begin with the 5'end. Start protein at the AUG sequence. mRNA Protein
4. After reading the lab for next week, use the following simulated DNA gel to answer the questions. a. Label the bands of the two-log ladder with the lowest band as the lowest number of kilobases (far left column or lane) b. Draw an arrow indicating the direction the DNA fragments travelled c. Estimate the number of kilobases in the unknown DNA in lanes 7 and 8 MW 1 2 3 4 5 6 7 8
3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut DNA, how many DNA fragments will result? Circle the fragments. Uncut DNA 1: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTTAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Number of fragments: Uncut DNA 2: Number of fragments: Length of fragments: TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Uncut DNA 3: basepairs (ignore ends with unpaired bases) Length of fragments: basepairs (ignore ends with unpaired bases) TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGCATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACGTAAGTTTTTT Number of fragments: Length of fragments: basepairs (ignore ends with unpaired bases) 4. You are given a new sample of DNA that matches one of the uncut samples above (1, 2, or 3). How could you use restriction enzyme analysis to match your unknown sample to one of the known samples (1, 2, or 3)? Explain below.
Choose J [Choose] DNA cloning DNA sequencing DNA technology biotechnology nucleic acid hybridization
Hind III' Hind III .9 kb .9 kb Bam HI plasmid A .9 kb .7kb Bam HI .3 kb plasmid B .9 kb .4 kb .3 kb .5 kb/ Eco RI Bgl Il .4 kb Eco RI .7 kb .5 kb -Bgl II Bam HI Eco RI You requested that a lab run by a friend of yours share a couple of plasmids that they created with you. She was willing to send you the ones that you asked for in exchange for citation in any papers that were published using the plasmids. Eco RI However, the labels from two vials have fallen off in the shipping because the adhesive used to hold them was not able to withstand the temperature, being shipped on dry ice. Each vial contained a different plasmid and now you do not know which plasmid is in which. Fortunately, you have restriction maps for both plasmids, shown above. Explain how you would determine which vial contained each plasmid and give a graphical representation of your expectations related to your method of Bam HI discovery. (25pts)
Choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I RNAse H Flap 1 DNA gyrase Pol α DNA helicase Primase Single chromosome Multiple points in chromosomes DNA ligase Not applicable 7. Adds more nucleotides in the leading strand of prokaryotes 8. Make primers for the replicative enzymes in eukaryotes 9. Primosome in prokaryotes 10. Removal of prokaryotic primer 11. Adds more nucleotides in the leading strand of eukaryotes
y Cours S DIOE The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). Kpn I Sall Eco RI Pst Bam HI Xho Bam HI Pst i Eco RI Kon I 100 200 300 400 500 B00 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 How many total restriction fragments will result if you complete digest the DNA fragment above with Sal I? cross out a. 1 cross out b. 2 cross out O c. 3 cross out d. 4 cross out e. 5 cross out O f. 6 cross out g. 7 cross out Oh. 8 The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). t of Sal Eco RI Pat Xhol Bam HI Psti Eco RI Koni Kpn i Bam H
4. A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gel electrophoresis, to yield the gel profile shown below. The first lane contains the size marker (M). M Undigested EcoRI control PvuII ECORI + PvuI 12000 bp 9000 bp 6000 bp 5000 bp 4000 bp 2000 bp 1000 bp Explain how the name of the enzyme ECORI is derived. How many sites are there for EcoRI and PvuII respectively on this DNA fragment? b) c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNA fragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on the map.
Section B: Circular DNA Eco01091 2698 Pfol 46 BSTAPI 179 Aatll 2641 Sspl 2525 Ndel 183 Ehel 235 Pdml 2318 396 MCS lacz 146 Bcgl 2239 Scal 2201 \2510 236 476 493 PUC57 2710 bp BsaXI 683 Sapl 707 876, AfillI, Pscl 830 Gsul 1808 Cfr101 1803- Eco311 1790 Eam11051 1718 1650 1490 rep (PMB1) \BseYl 1134 \Cail 1241 te fenen P S GTAA AAC GAC Goc CA TGA ATT CGA GCT CGG TAC CTc cCG AAT GCA TCT AGA TAT CGG ATC ccG Gạc ccG TCG ACT GCA GAG GCC TGC ATG CAA GCT Too 3' CATT TO Cra cco orC ACT TAA OCT COA GCC ATG GAG cOC TTA COT AGA TCT ATA GCC TAG 0oc coa 00C AGC TGA COT CTC c00 ACO TACOTT COA Ace Lad Va V Al Le Se Aen Ser Se P Val C Arn e Cy Ag Ser e Pe A Arg Als Arg Arg Se O Le ay Al His Le Ser e caT AAT CAT Gar CAT AGC Tor Tre era 3 OCA TTA GTA CCA GTATOSACA AAG GAC S The le Met The Met 1. You have a circular plasmid (PUC57), which consists of 2710 bp. What would the number and length of the fragments be if you cut the plasmid with the following restriction enzymes or a combination of enzymes?. Show…
32 pls answer i dont have clear picture of image just analyze and don reject ty

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS