3. Why can DNA adopt both A- and B- forms, while RNA is restricted to the A-form?
Q: "Implementation of PAT system in manufacturing of pharmaceuticals results in less validation and…
A: The term 'Process Analytical Technology' or 'PAT' was coined by the pharmaceutical industry and IPQC…
Q: please explain how to solve this type of questions
A: Each amino acid's preference for the alpha or beta secondary structure can be estimated. The…
Q: Do carbohydrates and sugars cause weight gain? Explain your answer.
A: Your body receives 4 calories from every gram of carbohydrates. You will gain weight if you consume…
Q: Which reaction or reactions of glycolysis require NAD* as a reactant? Which reaction or reactions in…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Based on your molecular weight predictions from computational analysis of the DHFR fusion proteins…
A: Glutathione S-transferase (GST): Affinity tags are efficient methods that have been employed…
Q: A biotech company sells a "reporter assay kit" for researchers to easily find small molecules that…
A: The glucocorticoid receptor is a type 1 hormone receptor. The receptor dissociates from the chaperon…
Q: Mechanism of action of electron transport inhibitors. Amital.
A: INTRODUCTION : First of all, there is no electron transport inhibitor called Amital, it is a wrong…
Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…
A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…
Q: Compare and contrast biochemical pathways. Describe the chemistry of the last three steps of the…
A: The citric acid cycle involves the oxidation of acetyl-CoA into CO2 and H2O. The beta-oxidation is…
Q: COMPLETE ALL CALCULATIONS REQUIRED FOR TABLE 1 ( For all measurements, the [PNPP] concentration will…
A: P-Nitrophenyl phosphate Assay is an enzyme assay conducted for the enzyme alkaline or acid…
Q: true/false: N-acetyl glutamate regulates the urea cycle by increasing the transcription of the…
A: Urea cycle is an important catabolic pathway in which ammonia is removed from the body in the form…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: In the reaction mechanism catalysed by glucokinase, glucokinase binds and brings ATP and glucose…
Q: 1 which parts of amino acids are involved in tertiary structures ? 2 polar side chain can make…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Which of the following is 18:248,11?
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: The first step in the catabolism of most amino acids is which of the following? Transfer of alpha…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Which two statements below accurately describe the roles of insulin and glucagon in maintaining…
A: Glucagon is a hormone secreted by the pancreas that controls the blood glucose level. It prevents…
Q: Catabolism - draw the complete citric acid cylcle for myristate
A: Myristate is a saturated fatty acid with 14 carbon atoms. Fatty acids are metabolized through the…
Q: [Select] [Select] [Select] transport. V transport. would move across a membrane using simple…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: Glucokinase is the enzyme that catalyses the phosphorylation of glucose in hepatocytes. It occurs…
Q: name this reaction
A: The catabolic process of glycolysis is performed by almost every living cell. Glycolysis is the…
Q: A(n) (hydrolysis, oxidation reduction, group transfer, isomerization, internal rearrangment)…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: 1. Compute the concentration of the standard solutions by completing Table B.1. Report your answers…
A: Bradford assay is a method to estimate the protein concentration in the given sample. It is based on…
Q: At pH 10, what is the net charge of the peptide Asn-His-Glu-Cys-Ser-Lys?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introducion Transcription is a process by which mRNA is produced from DNA and protein is produced…
Q: Draw a lipid exhibiting both an ether-linked and ester-linked acyl group attached to a glycerol…
A: Lipids are made up of fatty acids. they are insoluble in water. Lipids are important constituents of…
Q: Which of the following statements is correct regarding the structures below? CHO CHO но-н H H-OH ОН…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: Would increasing the concentration of glucose be a physiologically reasonable way to increase the…
A: Glycolysis is the 10-step enzymatic conversion of one molecule of glucose to two molecules of…
Q: 2. Draw the structure of the fatty acid, 16:247,10, as it occurs at pH 7. Make sure double bonds…
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: Aerobic glycolysis can produce ATP at a much faster rate than anaerobic oxidative phosphorylation.…
A: Pyruvate has a distinct outcome in anaerobic environments. Pyruvate is changed into lactate by the…
Q: 1. Draw (or insert) the general formula of an amino acid and label the four components. Which one…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question for…
Q: Which of the following is a structure of a sugar alcohol? Н I I H O CAB O CAR O CAP COOH OH нон CAT…
A: Sugar alcohols are formed when the aldehyde or keto group of the monosaccharide is treated with a…
Q: If a slight deficiency in the Vitamin B1 derivative Thiamine Pyrophosphate (TPP) leads to an…
A: TPP is a cofactor used by many enzymes. TPP helps to cleave bonds near to a carbonyl carbon.
Q: The hormone interacts with the metabotropic receptor, as a result of further implementation of the…
A: The G protein is a protein found associated with G protein-coupled receptors. The receptor coupled…
Q: 1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions…
A: Introduction DNA acts as genetic material in prokaryotes and eukaryotes. DNA replication is a…
Q: Form DIANINE name using the one-letter symbol and draw it as a peptide chain. Name the peptide as…
A: The given peptide has seven amino acids. The individual amino acids in a peptide are joined by the…
Q: Elaidic acid is an 18 carbon fatty acid with a trans double bond at carbon 9 that is produced in…
A: The major physical property of fatty acid is their melting point, which in-turn define at which…
Q: 3. After the competition, the athlete's lactic acid content is 4 mmol/l. Can this be considered a…
A: Lactate is created more quickly and cannot be removed, it builds up in muscle fibers. Lactate is a…
Q: Enzymes as biological catalysts of metabolic reactions. Properties of enzymes as protein substances.
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: provide 3 example pathway of oxaloacetate to other biomolecules.
A: Oxaloacetate is a four-carbon-containing organic compound. It acts as a metabolic intermediate in…
Q: Which of the following is the base component of the intracellular buffer? H₂CO3 HCO3 O H3PO4 O H₂PO4…
A: Buffers enable biological systems to maintain the pH within a particular range. Intracellular…
Q: Metabolic flux is regulated by both availability of substrates and level of enzyme activity. Match…
A: Enzymes are proteins which increase the rate of biochemical reactions. They carry out the quick…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: What is the single definitive test for galactose? State the principle.
A: Galactose is a monosaccharide . it combines with glucose to form a disaccharide called lactose. It…
Q: Which of the following monosaccharide phosphates is NOT produced in the pentose phosphate pathway?…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: As Build's laboratory partner, help him determine the following: 1. maximum amount of the unknown…
A: Gel filtration chromatography is a type of chromatography in which proteins are separated based on…
Q: The word root erythr/o means?
A: INTRODUCTION : Word roots in medical field - In the field of Medical science , a different and…
Q: OOC 1 H₂C H₂C H₂C-C HC H₂C NH NO HN Coo 1 CH₂ T CH₂ C-CH, CH C-CH₂ G=CH₂ "OOC 1 H₂C H₂C T H₂C H₂C-C…
A: Hemoglobin has four subunits, in which each has a heme group. The heme group is a heterocyclic…
Q: Draw the electron pushing mechanism
A: Electron pushing mechanism shows the jumping of electrons in the substrate and reaction…
Q: Q10.1: Answer the following three-part question. a) Calculate the ΔEº’ for the citrate cycle…
A: Converting malate to oxaloacetate: The regeneration of oxaloacetate in the citric acid cycle is…
Q: In the presence of O₂ and low energy status of the cell, acetyl CoA is oxidized to oxygen O lactate…
A: Acetyl Co A is a two carbon and an important biochemical molecule which is a connecting link of…
Step by step
Solved in 2 steps
- 2. Suppose the following base sequence was found in a 20-base DNA polymer. C-A-G-T-T-A-A-G-G-T-C-C-T-A-G-G-T-T a. What would be the bases in the complementary strand of DNA? b. What would be the mRNA strand transcribed? c. What would be the corresponding tRNA anticodons? d. What are the amino acids coded by the transcribed mRNA?4. Which of the following single-stranded DNA molecules would be palindromic in the double-stranded state? (A-T-G-C-C-G-T-A, G-T-C-A-T-G-A-C, A-T-G-C-T-A-C-G, G-C-T-A-T-G-A-C)1. If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? 2. When DNA replicates, how is it able to “unwind” its double helix? 3. What are the types and major functions for each type of RNA?
- 13.)Which describe the similarities and differences in the composition of DNA and RNA? a.)In DNA Thymine paired with Cytosine (T - C): In RNA Guanine paired with Cytosine (G - C) b.)In DNA Thymine paired with Adenine (T - A): In RNA Adenine paired with Uracil (A - U) c.)In DNA Guanine paired with Cytosine (G - C): In RNA Adenine paired with Uracil (U - A) d.)In DNA Thymine paired with Adenine (T - A): In RNA Adenine paired with Thymine (A - T) 14.)Most bacteria that cause sickness in humans grow best at 98. 6 degree Fahrenheit (37 degree Celsius). Sometimes a fever is the body’s response to the bacteria. What is the reason for developing a fever? a.)To make you feel miserable b.)Increasing the temperature of the body to kill bacteria c.)Decreasing the temperature of the body to kill bacteria d.) None of these 15.)The complementary base of Adenine in RNA. a.)Guanine b.)Thymine c.)Uracil d.)Cystosine1. Explain the central dogma - how DNA, RNA, and proteins are related.2. Predict the following sequences of base in the DNA strands complementary to the single RNA strand: • 3'A-G-T-C-G-T-A-C-A-T-G 5 • 5'G-T-C-G-T-A-C-T-A-G-C 3' • 5'C-A-T-G-C-T-A-G-C-T-A 3' • 3'A-T-C-A-T-G-C-G-T-A-C 5' • 5'T-G-A-C-G-T-A-C-G-A-T 3
- 16. The process of attaching biological functions to DNA sequences is called?1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in the form of a large palindrome. The RNA is transported to the cytoplasm and folds into a hairpin loop of double stranded RNA. In the cytoplasm, the hairpin loop is recognized by a double-stranded RNA cutting enzyme (dicer) and is cut into 21 BP lengths. When these 21 BP double stranded segments are combined with protein, they function by: Answer choices destroying specific mRNAs priming the synthesis of DNA sequences adding DNA to the chromosome ends (telomeres) acting as decoys for RNA degrading enzymes thus protecting the mRNAs present splicing the introns out of messenger RNA 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from…1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?
- 4. Which of the following mutations would be silent, missense, nonsense, or frameshift? The original DNA strand is 5'-ATGGGACTAGATACC-3'. (Note: Only the coding strand is shown; the first codon is methionine.) A. 5'-ATGGGTCTAGATACC-3' B. 5'-ATGCGACTAGATACC-3' C. 5'-ATGGGACTAGTTACC-3' D. 5'-ATGGGACTAAGATACC-3'5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3' a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & III4. Within this double-stranded segment of DNA, there is a protein-coding region for a gene. 3'-AATATGACGTCAGTAGA- 5' CODING STRAND ||| || || | || ||||| || 5'-TTATACTGCAGTCA TCT-3' a. Identify on which strand the gene begins. Draw a box around the start codon. (1 pt) b. Which strand will RNA polymerase follow when it transcribes the gene? (.5 pts) c. In what direction will it transcribe? Draw an arrow above or below the DNA strands to indicate. (0.5 pts) d. Write the RNA sequence that would be transcribed below. (1 pt) 5'- - 3' e. Write the amino acid sequence that would be produced during translation (use the codon table below). (1 pt)