Answered: 23. Use the amino acid chart in your…

Name: 23. Use the amino acid chart in your notes to translate the sequence
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 23. Use the amino acid chart in your notes to translate the sequence of codons (from #16) and write theamino acid sequence that results below:Amino Acid Sequence: 16. Create a matching (complementary) mRNA sequence for the following strand of a DNA

Science

Biology

23. Use the amino acid chart in your notes to translate the sequence of codons (from #16) and write the amino acid sequence that results below: Amino Acid Sequence:

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

Give the translation of the segment of a polypeptide chain below. Specify your template strand. —ссстAс стссттс сттссссА — |||||||||||||||| ||||| -cC GATCGACGAA GGA ACCCC T-
1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队相阳阳一即即的 9 First letter…
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
Muscle cells and neurons have the exact same DNA, however, they look very different and perform different functions. Explain why.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.
30. Below is a pre-mRNA sequence that contains 2 exons and an intronic region. Based on your knowledge of the spicing reaction, predict the ligated exon sequence. [ | (hint: there is a consensus sequence for this "cut n paste' rxn.] 5'-ACGACAGGAUGAAGGUAAAUCGGGUAGGGGCGGCUGACUCUCUUUUUCCCUCAGGUCGUAA-3'
A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the nucleotide sequence in the complementary DNA strand and then (b) the sequence transcribed from the template strand in mRNA DNA information strand: 5’ AAC GTT CAA ACT GTC 3’
Show the expected labeled cleavage products if the following DNA segment were subjected to each of the four cleavage reactions: 32P-A-A-C-A-T-G-G-C-G-C-T-T-A-T-G-A-C-G-A
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… a)Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strand.