2. Find errors, if any in the following function prototype. each error) a. float average(x,y); b. int mul(int a,b); c. int display(...); d. void Vect(int &V, int & size);

When a function accepts several arguments, how important is it what order those arguments are sent in?

Complete the code that returns the value of f(x), which has the value 1 inside the range −1 ≤ x ≤ 1 otherwise it is the value 0. f(x) [ ] # complete the function to return the value of 1, x = [-1, 1] 0, otherwise #f(x) given x. # return as the value called variable def function_f(x): # YOUR CODE HERE return fval "fval" ## Check your code below using print command ← → +0 0+

C++ Coding: ArraysTrue and False Code function definitions for eoNum() and output(): Both eoNum() and output() are recursive functions. output() stores the even/odd value in an array. Store 0 if the element in the data array is even and store 1 if the element in the data array is odd. eoNum() displays all the values in an array to the console.

def truth_value(integer):    """Convert an integer into a truth value."""    # Convert 0 into False and all other integers,    # including 1, into True    if integer == 0:        truth_value = False    else:        truth_value = True    return truth_value Now, write a function that goes in the opposite direction of the truth_value() function. This new function should convert a truth value into an integer. In particular, True should be converted into 1 and False into 0. Name the new function integer_0_or_1(). All you need to include below is your definition of the function integer_0_or_1(). It will be tested automatically against relevant inputs. So include your function and nothing more.

I can both pass and return an array value from a function. Group of answer choices: True False   this is for c++

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

4. Function prototype for functions a. displayMenu b. clearScreen c. memoryManagement d. displayProcess e. firstFit f. worstFit g. bestFit h. nextFit 5. Write the main function to do the following a. Return type int b. Empty parameter list c. Declare a variable, data type integer, to store selection (i.e. choice), initialized to -1

Functions like print which perform an action but don’t return a value are called: Select one: a. recursive functions b. built-in functions c. simple functions d. utility functions e. void functions

Matlab Question