2. Describe each of the trends in primate evolution and why it's beneficial: Description Benefit Prehensile hands and feet/opposable thumbs Stereoscopic vision Large, complex brain Reduced reproductive rate

2. Describe each of the trends in primate evolution and why it's beneficial: Description Benefit Prehensile hands and feet/opposable thumbs Stereoscopic vision Large, complex brain Reduced reproductive rate

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter32: Deuterostomes: Vertebrates And Their Closest Relatives

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Related questions

Q: 16. Describe how each of the following compounds participate in energy metabolism. a) Pyruvic acid…

A: The cellular respiration involves breakdown of glucose and production of energy in the form of ATP…

Q: Explain the types of RNA & explain how they play role in the process of protein synthesis.

A: Explain the types of RNA & explain how they play role in the process of protein synthesis.…

Q: Choose the incorrect option regarding protein motifs They lose their structure after breaking away…

A: Introduction Proteins are macromolecules made up of one or more long chains of amino acid residues.…

Q: * The intensity of x-ray beam directly proportional with the atomic number of the anode material…

A: Introduction A therapy, often known as a medical treatment, is an attempt to treat a health problem…

Q: What is meant by energy flow in an ecosystem? What are the laws of thermodynamics?

A: Introduction An ecosystem is a geographical area in which plants, animals, and other species, as…

Q: at rest, a cell has a negative charge inside the plasma membrane and a positive charge outside the…

A: Introduction Animal cell is surrounded by a plasma membrane. Plasma membrane is a selectively…

Q: To determine: Whether the life cycle and habitats of other fungal groups permit them to grow as…

A: Fungi are a type of eukaryotic creature that decomposes dead organic substances in the environment.…

Q: Which of the following pairs is mismatched? a. effector memory γ:δ T cells; CD45RA b. splenic…

A: T and B cells are the lymphocytes that generate the specific immunity.

Q: Q3.9. For which of the following is potential energy DECREASING? (Hint: Click here to see an…

A: INTRODUCTION Potential energy is stored in living cells in the form of ATP.

Q: Clearly distinguish between the 3 parts of glycolysis.

A: The breakdown of glucose to provide energy is known as glycolysis. Pyruvate, ATP, NADH, and water…

Q: True or false: The hydrolysis of ATP is exergonic (spontaneous) True False

A: Metabolism is a phenomenon in which energy is either liberated or formed . Metabolism is classified…

Q: How does DNA profiling make use of genetic variation in DNA sequences

A: DNA profiling is also called DNA fingerprinting.

Q: 7 Use the following images to answer the next two questions. 5 6 Stage 8 in the diagram above is…

A: The given diagram illustrates cell division. There are two types of cell division - mitosis and…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: produce" offspring with traits of your liking, would you do it? If you have to limit this, what…

A: Genetic engineering Genetic engineering deals with the editing and alteration of genes/ genetic…

Q: Which of the following statements best describes the inheritance pattern of an X-linked dominant…

A: Pedigree is a family chart showing the inheritance of a particular trait through several generations…

Q: Distinguish between a hypersensitive response and systemicacquired resistance in plants

A: Plant hypersensitive response (HR) rapid confined cell death is occurring at the site of pathogen…

Q: What is the most important reason for evolution of bacteria? Explain briefly. GiG of cancer by…

A: Bacterial evolution has continued over the billions of the years since the precambian time period.…

Q: S. tu

A: 1.Answer--- Some of the techniques are used for resolution up to species and strain levels are as…

Q: , what are the best practises to implement?

A: Data breach requires a series of steps to manage .it is important for the health care organization…

Q: 1. Compounds with the same molecular formulas like glucose and fructose are called ______________.…

A: Glucose and fructose are simple sugars. Sucrose is a disaccharide made of glucose and fructose.

Q: Cohort: Order: Genus: Common Name:

A: Phylum Platyhelminthes Platyhelminthes are the soft body invertebrates flattened animals.

Q: 35, 34 33. 36 32 38. 37. 31- 30- 39. 40, 29 28 27 26 25 45 43 44 24 23 46 L 22 21 2 20 W 6 18. 16 17…

A: The 72 hours chicken embryo contains a bigger embryonic area and four flexures. It contains a…

Q: A transmembrane protein has the following properties: it has two binding sites, one for solute A and…

A: Introduction :- Transmembrane proteins (TP) are integral membrane proteins that traverse the entire…

Q: STR ⒸDigital Frog International A B

A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system,…

Q: What is the proper term for the group of reproductive cells that pass genes on to the next…

A: Reproductive cells are formed through meiosis. Meiosis is reductional division.

Q: The role of health promotion in improving population health is vital, focusing on one of: smoking,…

Q: Q35. Which of the following is a dangerous effect of anabolic steroids? Answers A. loss of hair. B.…

A: When ingested into a living system, drugs are any chemical compounds that affect/alter the…

Q: What will you do on an exam or problem set regarding fungal genetics if the longest distance is…

A: Microbiology is the branch of biological sciences which deals with microorganisms. Microorganisms or…

Q: What clinical symptoms can an inherited deficiency in complement components C3 or C4 lead to?

A: Introduction: There are three primary pathways in the complement cascade, each of which is activated…

Q: Which of the following holds true if a woman carries one defective Bruton’s tyrosine kinase (BTK)…

A: BTK was initially identified as a crucial modulator of B cell receptor signalling in the formation…

Q: If twin brothers fathered 2 boys, (one each) by different women, would the 2 boys have any simular…

A: The human genome is a full set of nucleic acid sequences for humans, encoded as DNA in cell nuclei's…

Q: Why does the hydrolysis of ATP release so much energy? Because very strong bonds are required…

A: The mechanism of ATP hydrolysis is an exergonic one. It generates adenosine diphosphate (ADP),…

Q: Explain structural adaptations necessary for the invasion of dry plants and also state which…

A: Land plants evolving strategies to survive increasing over evolutionary time. Plants are known to…

Q: Which of the following is true about integral proteins according to the fluid mosaic model? Integral…

A: Introduction According to the fluid mosaic model there are different types of proteins within the…

Q: From the information provided in the table, calculate delta G' and Keq value at 298K for the redox…

A: The G' = +24.986 KJ/K/mol and Keq=4.13×10-5 KJ/mol at 298K for the redox reaction that occurs in…

Q: A microbiology professor noted that in the fall when the apples are ripe, her cow, appropriately…

A: Introduction : The pyruvic acid produced during glycolysis is exposed to oxidative decarboxylation…

Q: Explain The Central Dogma of Molecular Biology, highlighting the process of protein synthesis.

Q: We will see an MII pattern when: There is no crossover between a gene and its centromere There is…

A: Crossover is the process of the exchange of genetic segments that occurs between homologous…

Q: We can determine the expected number of DCO individuals among the progeny of a trihybrid cross by:…

A: When chromosome fragments are exchanged in two sites, it is called a double crossing. The two ends…

Q: 11. Why is cell membrane said to be selectively permeable? * A. because of the polar nature of tail…

A: The plasma membrane which is also known as cell membrane is the membrane found in all the cells that…

Q: An adequate sample size controls for chance events and individual variationsin response and thus…

A: In order to conclude a result for an experiment, a sample size is very important. Sample size is…

Q: Sketch the four gametes produced by a CROSSOVER between C and D and label whether or not each gamete…

A: Inversion - An inversion is a chromosome rearrangement in which a segment of a chromosome is…

Q: Select the tool below that is not used for body composition measurement? Select one: O a.…

A: Body composition measurement is done by breaking down the human body into its individual components…

Q: A rise in the intracellular Ca2+ concentration causes muscle cells to contract. in addition to an…

A: Introduction :- Calcium pumps are a type of ion transporter found in all animal cells' cell…

Q: hy the MMR is important and evaluate the effectiveness of the vaccine for infants

A: The technique of generating immunity to an infectious organism is known as immunisation. Infants and…

Q: Imagine you work for an industrial chemical company and you have been asked to design a novel…

A: Q. Imagine you work for an industrial chemical company and you have been asked to design a novel…

Q: What are the basic components of a Fluorescence Microscope and what are the functions of each? Are…

A: Microscopes are laboratory instruments that are used to view and study things that cannot be seen…

Q: Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G…

A: Introduction Protein synthesis is important as it does various functions in each cell. Without…

Concept explainers

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.

Question

2. Describe each of the trends in primate evolution and why it's beneficial:
Description
Benefit
Prehensile hands and
feet/opposable thumbs
Stereoscopic vision
Large, complex brain
Reduced reproductive rate

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

When systematists study morphological or behavioral traits to reconstruct the evolutionary history of a group of animals, they assume that: a. similarities and differences in phenotypic characters reflectunderlying genetic similarities and differences. b. the animals use exactly the same traits to identify appropriatemates. c. differences in these traits caused speciation in the past. d. the adaptive value of these traits can be explained. e. variations in these traits are produced by environmentaleffects during development.
1. There are two main groups of bats: Smaller “microbats” navigate by using sonar, and larger “megabats” rely on vision. Mammalogists once thought that both kinds of bats evolve from insectivorous mammals. But similarities between the visual systems of megabats and primates have led some researchers to think that megabats may have evolved from primates, perhaps lemurs. What results would support the hypothesis that the two groups of bats have a common origin? Separate origins?
1. Zoologists refer to morphological and genetic similarities in animals when investigating about their evolutionary relationships, describe how these two methods work and indicate their advantages and disadvantages (at least 2 for each method). 2. Aside from the principles of evolution, a study of the interactions of organisms with their environment is also significant in understanding Zoology. Give at least two significances of studying ecology in relation to understanding animals.
27. Why are humans classified as Primates – be sure to include the criteria for being a Primate? What other organisms are in that group?
1. Which of the following is the most reliable source that taxonomists use to classiny mi anatomy behavior developmental patterns biochemistry 2. Circle all of the following scientific names for the green toad that are written correctly. bufo Regularis Bufo Regularis Bufo regularis Bufo regularis Bufo Regularis 3. Which level of classification is represented by the top of evolutionary trees? Kingdom Order Family Species Class 4. Place the hierarchy of classification in order from the broadest (1) to the most specific (8) category. 1. 2. 3. 4. 5. 6. 7.
Describe how changes in the ladybugs'environment may influence their survival and/or reproduction. Make sure to use the vocabulary terms adaptation, natural selection, and polymorphic.
The Hominoidea is a monophyletic group that includes: a. apes and monkeys. b. apes only. c. humans and human ancestors. d. apes and humans. e. monkeys, apes, and humans.
Define natural selection using the 5 points below to explain its role in understanding primate behavior. (1) there is variation among individuals; (2) some of that variation is heritable; (3) there is always competition between individuals for resources; (4) some variants outcompete other variants and leave more offspring; (5) to the extent that the parent's traits are heritable, then a larger portion of the next generation will reflect those traits.
hat I Can Do The evolution of man is one of the most fascinating discussion and discovery in the field of science. Humans as the race that have dominated the Earth and seem to be at the center of it have evolved greatly. Observe the illustration on the left. The common ancestor of the primates like chimpanzees and humans might look like a primitive primate with four limbs on which the forelimbs are used to hang on trees. After some time, the emergence of humans has marked a great change on the history of life on Earth. In your point of view as a senior high school STEM student, are humans still evolving? Provide evidences for your answer.
1. Explain how all 4 of the evolutionary aspects (mutation, gene flow,selection, and genetic drift) affect/have affected dogs for better or worse in present time ( or past time if relevant). Provide specific examples. 2. Explain how all 4 of the ecological interaction (mutualism, competition, predation, parasitism) affect/have affected dogs. Provide specifiv examples. Thank you
20. All primates share the following characteristics except: A. They all have traits B. They are endothermic C. They nurse their young D. A heterodontic dentidor
3. If humans evolved from apes, then why are there still apes? Additional readings: https://evolution-outreach.biomedcentral.com/articles/10.1007/s12052-010-0293-2 https://books.google.com.ph/books?hl=en&Ir=&id=DVEakAgAAQBAJ&oi=fnd&pg=PA3&d q=+lf+humans+evolved+from+apes,+then+why+are+there+still+apes%3F&ots=zJ4ym- 9JRX&sig=4qT8KHp23ZIHT5UHUn5wLfIPLOM&redir_esc=y#v=onepage&q=lf%20human s%20evolved%20from%20apes%2C%20then%20why%20are%20there%20still%20apes%3 F&f=false