14) Should you measure the radius or diameter of the zone of inhibition?

67. Choose the option correct asap  What is a way to record the signal from a single neuron?     a. Two recording electrodes can measure the difference in charge.     b. An fMRI scan can single out a single neuron.     c. An EEG will record individual neurons.     d. A recording electrode and a reference electrode can measure the difference in charge.

1. What are the symptoms of Alzheimer's disease?

33. An 8-year-old client with a head injury is brought to the healthcare facility by her parents. The parents report that the child injured herself during a seizure episode. Her medical history suggests that she has grand mal seizures, during which she cries out loudly, falls suddenly, and has alternating rigid body contractions and jerking. The parents are worried about their child's safety and want to know how they can prevent injury to the child. What instructions should the nurse provide regarding precautions to be taken?

8. Describe the differences between ionotropic and metabotropic signaling in the brain with respect to receptor properties and duration

Please ASAP. Thanku. 7. Which of the following statements about the lateral geniculate nucleus of the thalamus (LGN) is FALSE?   A. The LGN is organized into six main layers, with layers that contain konicellular cells in between   B. The parvocellular pathway is important for detecting the direction of movement of visual objects   C. There are two magnocellular layers.   D. There are four layers that contain small parvocellular cells.   E. The LGN relays information from the parvocellular and magnocellular pathway

3. GABA is commonly introduced as the most prominent inhibitory neurotransmitter in our brains. However, scientists have discovered that GABA does not always lead to the inhibition of a postsynaptic neuron. Explain how this is possible for neurotransmitters more generally. In other words, describe how it is possible for the same neurotransmitter to cause either a depolarizing or hyperpolarizing effect at different postsynaptic synapses. Make sure you clearly explain the reasoning behind your answer.

12

7. You stimulate a presynaptic cell and record from the postsynaptic neuron of each pair. For each mutation below, describe the following: i) After the first stimulus, how does the excitatory postsynaptic potential (EPSP) you record from the postsynaptic neuron differ from the EPSP recorded from a wild-type animal? Does it increase, decrease, stay comparatively the same, or fail to be generated at all? ii) After five stimulations of the presynaptic cell in quick succession, how does the EPSP you record from the mutant animal differ from that in the same experiment on a wild-type animal? Explain your reasoning in each case. The mutations are as follows: 7A. Mutation of the voltage-gated Ca2+ channels of the presynaptic terminal. The mutant channels have a lower opening threshold.

4. Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC TCTGGATTTTCCCCCGGCGGCGGCGCGCGCGCGCGCGTGTGTGTCCCACAC AGGGCCCCCAGGCTGGACCCACCCGGCCTGCTGCTCGAGCTGCGCTCCGGT GGTCGCGGTGCT Which of the following is least likely to assist you in optimizing the reaction? a. Increase the denaturation temperature b. Use a thermostable polymerase that has a lengthy half-life at 95°C c. Supplement the reaction mix with DMSO, formamide, urea, or Betaine d. Lower the primer annealing temperature e. Use a dNTP mix with 7-deaza-dGTP