1. There is evidence to dispove Crick's (1958) Central Dogma of Molecular Biology. one such evidence is how the coronavirus replicates genetic information. Explain fully how this process disproves Crick's Central Dogma

just answer question ---  dont need explanation

What might happen if you did not minimize the chances of the designed RNAS pairing with one of more human messenger RNA molecules-if you wanted to use these silencing RNAS in human cells to inactivate the coronavirus? 8. Finally, if you were going to use these as part of a potential drug-how would you the double-strand RNA to cells? Remember these are RNA molecules-how would you get them across the membrane into the cytoplasm, where they can be processed by Dicer. You can find many strategies for doing this on internet. Describe why this is a problem, and how it could potentially be solved. deliver

BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases

Show your work please

12. Which of the following are not the functional components of a simple retroviral genome?     gag, pol, and env genes   5' Untranslated regions   3' Untranslated regions   transgene 13.  One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is     allows quantification of transcripts over five orders of magnitude   used to identify new transcripts and alternative isoforms   RNA-Seq is sensitive and offers a way of profiling transcripts of single cells   a significant amount of input RNA is required

Explain the Gene Expression Experiment Re-Analysis Summary of Rabies Virus(Taxon:11292) Explain how The virus attaches to the cell membrane of the host cell via the G protein. How the virus penetrates the cytoplasm and the ribonucleoprotein (RNP) complex is exposed to the cell's machinery. Explain Phylogenetic Analysis and Adenovirus Vaccine Cloning and Rationalization of Rabies Virus.

To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…

Replication of many RNA viruses depends on RNA polymerase. The antiviral drug ribavirin does not inhibit the polymerase but instead increases its error rate. Explain how this affects the virus.

08 Nucleoside and nucleotide analogs are two closely related classes of anti-viral drugs that inhibit viral DNA or RNA polymerase enzymes. What is their most common mechanism of action and why are they often referred to as "chain terminators"? Edit View Insert Format Tools Table A xd0 Paragraph v They are referred as chain terminators because the sturcutre when looked at does not contain a 3 prime end 31 8 8:10 EE O 6 n