Q: A bat is 100 ft. below and to the right of a moth, as shown in the diagram below. At this distance,…
A: A bat uses sonar to navigate and hunt in the dark. It does this by emitting high-frequency sound…
Q: 9) Researchers are interested in studying the health effects of 1-bromopropane, a solvent touted as…
A: There are different types of study designs that are used in the epidemiology. Researchers are…
Q: Out of these 8 hallmarks ( sustaining proliferative signaling, evading growth suppressors, resisting…
A: The cells multiply by cell division. It is a controlled process for the growth and development of…
Q: Since the first nucleotide cannot be directly linked in a newly synthesized strand in DNA…
A: Introduction DNA replication is the cloning of DNA molecule , in which each strand of DNA molecule…
Q: 5b. How did the results from this section show that membranes are "selectively permeable"?
A: The plasma membrane: Only some molecules can enter and leave the cell because the cell membrane is…
Q: how is evading growth receptors necessary for cancer development and how is it driving cancer…
A: The ability of cancer cells to evade anti-growth signalling is a crucial trait. Cancer cells must…
Q: 4. What specific type of transport process describes the movement of water across the dialysis…
A: The ease with which a molecule can flow through a cell membrane is referred to as "permeability".…
Q: Which of the following does not apply to the known model of DNA? Group of answer choices The…
A: The double helix model of DNA was proposed by James Watson and Francis Crick in 1953. The model…
Q: cystic fibrosis
A: Genetic abnormalities: These are the conditions which are caused by the changes to the genes or…
Q: When reading about the 8 hallmarks of cancer, rank them from the least important to most important…
A: Hallmarks of cancer include uncontrolled cell growth and the ability of cancer cells to invade other…
Q: 1. If the biuret technique is to be used exclusively for quantification of the albumin fraction, how…
A: The Biuret test is a protein test that looks for the existence of peptide bonds. The existence of…
Q: Question: I have an unknown bacteria project. I have been given two unknown bacteria. I found out…
A: In bacteriology, bacteria are classified into gram-positive and gram-negative based on the results…
Q: Describe how induced pluripotent stem cells are made, and how our studies of the inner cell mass in…
A: Potential uses for IPS cells include treating conditions including diabetes, Parkinson's disease,…
Q: 25) For Each of the following receptors indicate which type of sensory receptor it a. Male silkworms…
A: Sensory receptors are specialized cells that perceives a certain kind of stimulus. The sensory…
Q: A predator-prey relationship can potentially evolve into a mutualism. Group of answer choices True…
A: Mutualism is the interaction between the two organisms of the different species where both partners…
Q: The United States has banned the use of the pesticide DDT. Does this mean that DDT can no longer…
A: The first of the current synthetic insecticides, DDT (dichloro-diphenyl-trichloroethane), was…
Q: Using the glyoxylate cycle, a germinating plant can convert two molecules of acetyl CoA into one…
A: Biological membranes are divided into specific functional areas with distinct compositions that can…
Q: Consider the graphic that is presented and depicts the end-point for the following scenario. At…
A: Cladogram is a kind of diagrammatic tree which represents the relationship between the different…
Q: onsider the following null hypothesis: “The amount of emergency department visits is not related to…
A: Hypothesis:- The hypothesis is an assumption that can be made about the parameter of the population…
Q: During the Scientific Revolution, there was a breakthrough in medicine and chemistry. Can you…
A: Towards the second half of the Renaissance period, the sequence of discoveries in mathematics,…
Q: 8. Use the Hardy-Weinberg Equations to answer the questions below. (Assume there are only 2 alleles…
A: Introduction : In a large, random-mating population, the genotype and allele frequencies remain…
Q: Write 300 words essay on why some people eat dog meat and others do not
A: The muscle and other consumable components of dogs are known as "dog meat." Dog meat eating by…
Q: what are the effects of body position (sitting and reclining) and drinking a caffeinated soda/…
A: Blood pressure is the pressure of circulating blood against the walls of blood vessels. Most of this…
Q: what are the three most compelling reasons that would support NOT legalizing euthanasia?
A: The sanctity of life is less respected in society as a result of euthanasia. Accepting euthanasia…
Q: please answer i'll give thumbs up
A: The DNA sequence is read from the bottom of the gel to the top, including bands in all four lanes.…
Q: Which of the following is part of the extracellular matrix? Group of answer choices All of the other…
A: Introduction Cell signalling is part of a communication system that regulate cellular activities…
Q: Short Answer 1. The diagram below shows non-cyclic electron transfer and ATP synthesis by…
A: Introduction The oxidative phosphorylation process, which produces ATP, is made up of a series of…
Q: Problem: How might we decrease the rate of diet-related health issues among teenagers? Based on the…
A: The rate of diet-related health issues among teenagers is increasing. According to a study published…
Q: Explain the importance of different functional guilds of detrital macroinvertebrates (microbial…
A: Macro invertebrates perform the several function in aquatic environment. They perform crucial role…
Q: Explain the postulated mechanisms involved in an (atopic) asthmatic attack. What are the clinical…
A: Asthma is a long-term lung condition that is caused by narrowing of the airways when they become…
Q: Which of the following should be done when in a sleep deprived state? Reduce training volume…
A: In sleep deprived state, one has not slept properly. Generally a good sleep of 7-8hrs is necessary…
Q: Describe what happens to the chromosome through Meiosis 1 and Meiosis 2, and indicate how this…
A: Homologous pairs means it is the pair of chromosome in which one of the set (chromosome) is…
Q: 28. Determine if the trait above is dominant or recessive. Explain your answer using specific people…
A: A pedigree chart is similar to a family tree where it discusses the inheritance of a trait over…
Q: You set up two populations of fruit flies (Drosophila) in the lab in large enclosures. One…
A: In fruit flies (Drosophilia melanogaster) larvae, two foraging stratrgies are seen. These are sitter…
Q: Describe the given Giardia lamblia cyst and Giardia lamblia trophozoite under a microscope provided…
A: Giardia lamblia is a microscopic parasite that is a common cause of gastrointestinal illness in…
Q: Explain briefly why albumin, globulin and total protein are increased in dehydration but decreased…
A: Introduction: In the blood, there are primarily two forms of protein: Albumin, a substance that…
Q: (a) Relative fitness 1.50 1.25- 1.00- 0.75- BO NO 0.50- 31 32 generations generations, Net fitness…
A: i. males competed intensely for females, which resulted in selection for traits like 'high…
Q: Free Energy A+B a. Progress of the Reaction Line that represents energy of activation without enzyme…
A: Activation energy is the minimum amount of energy that is required by a reactant to convert it into…
Q: mutations. on PCOS (polycystic ovarian syndrome)
A: In the case of PCOS, the ovaries produce abnormally high levels of androgens, the male sex hormones…
Q: Describe how nondisjunction results in aneuploidy disorders, and describe the syndrome/ symptoms/…
A: Nondisjunction means the failure of homologous chromosomes or sister chromatids to separate during…
Q: (1) (2) (3) Which of the following residues would be most likely to make contact with the aqueous…
A: Proteins are intricate macromolecules made up of a large number of amino acids that are connected by…
Q: what does a biostatician do?
A: A biostatisticians collects data and perform analysis focusing on biology in the fields of…
Q: What is Primary Production and what are the factors that limit primary production in terrestrial and…
A: Primary productivity is referred as the speed at which solar energy is converted into the organic…
Q: LO19 Identify the evolutionary relationships between Archaea, Bacteria and Eukarya. Which of the…
A: Introduction : The three basic domains of life in nature are archaea, bacteria, and eukarya.…
Q: In the fruit fly Drosophila melanogaster, a recessive condition called eyeless (ey) significantly…
A: First draw all the possible gametes for both the gametes. All gametes means all, including the…
Q: When comparing the mode of action of benzopyrene with ethidium bromide, one sees that both have a…
A: Gel electrophoresis is characterized as a technique that is utilized for the separation of DNA…
Q: Describe the given Entamoeba coli cyst and Entamoeba coli trophozoite under a microscope provided…
A: Entamoeba coli is a species of parasitic amoeba that is found in the intestines of humans and other…
Q: I need a long introduction of all these topics: 1) Terrarium
A: We have diversity in many aspects, including culture, climate, and language. Because of the…
Q: Signaling can result in both fast and slow cellular responses. does the following statement…
A: Cell communication or signaling is the process that allows the cells to relay information and…
Q: Jean is the mother of Dani, Lelia, Jose and Pam. Alex could be the father, You use PCR analyze 2…
A: Polymerase chain reaction or PCR can be used to study the inheritance of genes thanks to the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- ... 2. Complete the leading strand and the complementary strand with the 5'and 3' ends and identify the corresponding codon as labelled V, H, L, T, P, E, E, and K respectively using Codon genetic chart. * GTGCATCTGACTCCTGAGGAGAAG CACGTAGACTGAGGACTCCTCTTC ..: DNA (transcription) GUGCAUCUGACUCCUGAGGAGAAG RNA (translation) V H LT .…. TPEEK protein26. What is the start codon and the corresponding amino acid for which it codes? FIISI DASO U G UUU UUC UUA U CUU CUC CUA CUG AUA AUG GUU GUC GUA GUG PHE AUU AUC ILE GAU-ASP LEU MET or START LEU GUA-VAL AGU-SER VAL AUG- MET UCU UCC UCA UCG C CCUT CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second base SER PRO THR ALA UAU UAC UAA UAG CAU CAC CAA CAG A GAUT GAC GAA 1 GAGJ STOP UGU TYR CYS UGC UGA STOP UGG TRP G HIS GLN AAC ASN AAA AAG J LYS ASP GLU G CGU CGC CGA CGGJ AGU AGC. AGA AGG GGU GGC GGA GGG >ARG SER ARG UCAG GLY UCAG UCAG UCAG THILD DASO REQUIRED E ce30. Below is a pre-mRNA sequence that contains 2 exons and an intronic region. Based on your knowledge of the spicing reaction, predict the ligated exon sequence. [ | (hint: there is a consensus sequence for this "cut n paste' rxn.] 5'-ACGACAGGAUGAAGGUAAAUCGGGUAGGGGCGGCUGACUCUCUUUUUCCCUCAGGUCGUAA-3'
- ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.20 46.Describe briefly the functions of the three types of RNA (tRNA, mRNA and rRNA) in protein translation.Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
- 37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
- Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)