. A 40-year-old woman presents with progressive palmoplantar pigmentation X-ray spine shows calcification of IV disk. On adding benedicts reagent to urine, it gives greenish brown precipitate and blue-black supernatant fluid. What is the diagnosis?

Q: I don't know what is that picture. I need help with the nameof label

A: The musculoskeletal or locomotor system is made by the collective contribution of bones, cartilage,…

Q: -A wild-type strain. -A strain that contains a 15 base-pair deletion in the lac operon operator…

A: The widely used and closely related Escherichia coli "wild types" W3110 and MG1655, as well as…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: 12. Which of the following half-reactions has the most positive redox potential? a. ½ 02 + 2e + 2H*…

A: Asked : Half reaction with most positive redox potential

Q: D

A: Cell membrane is one of the major components of the cell. The membrane consists of bilayer of…

Q: E

A: A gland can be defined as an organ that is capable of producing a substance that helps in performing…

Q: Please give me long detailed answer

A: Constitutive heterochromatin refers to regions of the genome that are consistently condensed and…

Q: 1. Observe the photograph of the gel containing your sample. Orient the photograph with wells at the…

A: In this exercise, we are presented with a photograph of a gel containing samples, possibly from a…

Q: The last part doesn't have an answer. Can someone help?

A: Introduction: BOD stands for Biochemical Oxygen Demand. It is a measure of the amount of oxygen…

Q: I want the full answer to this question please can someone help me

A: - A 67-year-old woman is admitted to the ICU with hypotension of unknown origin.- She is…

Q: could you please work the whole question out?

A: Answered the question.

Q: Please answer fast

A: Uninary tract infection (UTI) is an infection in any part of your urinary system — your kidneys,…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: What happens in your house when the temperature drops? On the next slide put the steps of this…

A: In order to maintain the temperature fluctuations various mechanisms occur inside the body which is…

Q: What is sick

A: An abnormal condition of an organism which interrupts the normal bodily functions that often leads…

Q: What is the Fischer projection of the nonulose structure above? H OH H OH HOH HOH H OH HOH H OH HOH…

A: The fischer projection of given nonulose structure is..  fischer projection is 2-D image of 3-D…

Q: This was previously rejected due to not including all parts of the question. I've added all parts in…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: i can't read that hand writing you suck

A: Dihybrid cross is an essential topic in the case of Mendelian genetics.. In the case of a dihybrid…

Q: i was thinking about A

A: Attentional control refers to control someone's attention towards a specific topic . It is very…

Q: Based on the tree above, which statement is true? You can make a clade with only A, B and C. A and B…

A: To solve this, it is necessary to understand what is cladogram? A cladogram is a systematic…