Quiz 3

I would like you to solve question 12.

Adec ct L AA AAe mo LAe AaB A Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on the line provided and below it identify the specific amino acids the codon coded for. DNA Sequence: ATG ATA GAA CCG GGT TAC CAT CGT GAT AGA 1. Insertion: ATG ATA Insert a nitrogen base 2 Deletion: ATG ATA GAA Delete a nimogen base REVISED KNOWLEDGE: Actual answers to the process questions/ focus questions I 1. Why is the base pairing in DNA important? Complementay base pairing is important in DNA as it allows the base pairs to be arranged

May I get help with question 3 please

Can I have some help with the following question ,thank you!

Question 1: Answer all practice question parts Label the leading and lagging strands below: 3' 5' 5° 3' Label the coding strand and template strand below: A protein is 285 amino acids long. The cell needs 10,000 copies of this protein. Based on this information please answer the following questions. How many ATPS will be needed to make this protein? How many moles of glucose will be needed to make this protein?

The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.

PLease help, double and triple check your answers, im using this to study, these questions are NOT graded they are PRACTICE problems

Can you help me solve this sequence question and identifty the mutation?

Explanation

How are introns recognized by snRNPs?Question 17 options: CTD of RNA polymerase II binds to cis-elements in the introns proteins bind to the major groove base-pairing between snRNAs and cis-elements in the introns

NOTE THIS: DECODE IT PLEASE JUST PROVIDE A BRIEF ANSWER. PLEASE HELP ME OUT, I'M BEGGING YOU PLEASE. THANK YOU SO MUCH IN ADVANCE

This is homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it!

The codon chart is shown below, what amino acid sequence does the DNA sequence: 3' TCAGCTAGA 5' code for?

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read? Edit Vicw Inscrt Format Tools Tablc Paragraph BIUA 2 T 12ptv

Do question 31

answer the other rows please

(THIS IS NOT GRADED.) This is NON-MANDATORY homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it! (I am using this for study material.)

I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946 nucleotides long. The urn contains 259 Adenines, 699 Cytosines, 401 Thymines and 587 Guanines How many start codons will I find on average in the entire sequence when I draw all of the bases from the urn without replacement? Please I'm not too sure how to tackle this.

Question In Image Thank you!

What is the answer of the question number 6 and 7?

Good afternoon, Guidance with this question would be most appriciated. Thank you for your time.  Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?

please help with question 1 and 2.

please answer part 5

Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a ribosome comes to one of these codons?

In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino acids and exon 3 has 3 amino acids. Remember start and stop codons! Highlight the introns and number the exons. Show the start codon and stop codon and highlight and number the exons. Remember all introns start with GT and end with AG. 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' (a) How many base pairs are in intron 1 and intron 2?

Can you please answer 32

64 codons specify 20 amino acids. There are two characteristics of codons: 1. No ambiguity: Each codon specifies only one amino acid 2. Redundancy: One amino acid is specified by more than one codon Question: What advantage we get from codon redundancy?

Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG

What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read this question carefully also? Are you certain? (You may list the three letter abbreviations for the amino acids listed below) DNA Sequence: TAC AAG CCC TAG GCG ATA АТС [a] Table 1. MRNA codons & associated amino acids Second base C G UUU Phe UUC UCU UAU UGU U Тyr UAC Cys UGC UCC Ser UCA UAA Stop UGA Stop A UUA Leu UUG UCG UAG Stop UGG Trp G CUU CCU CAU] His CAC CGU CUC C CUA CGC Leu Pro CCA Arg CGA CAA Gin CUG CCG CAG CGG AUU ACU AAU Asn AAC Thr AAA Lys AAG AGU Ser AGC AUC Ile ACC AUA AGA Arg AGG ACA AUG Met or start ACG GUU GCU GAU GGU Asp GAC U GÚC GCC Ala GCA GGC Val GUA Gly GAA GGA Glu GAG GUG GCG GGG G Cooriaht O Pearson Education. Inc Dublishina as Beniamin Cumminas First base (5' end) Third base (3' end)

What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5' Mutant:     3'-AGTCCCTGCAAT-5' Use the codon table if you need it. Answer choices: Deletion, Insertion, Missence, Silent I selected missence, but the answer is incorrect. Please help.

Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance.  Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide.     Types of Mutation  Changes in the Amino Acid 1.     2.     3.     4.

16

i need help with the answer

Which of the following mutational changes wouldyou predict to be the most deleterious to gene function?Explain your answers. 1. Insertion of a single nucleotide near the end of thecoding sequence.2. Removal of a single nucleotide near the beginningof the coding sequence.3. Deletion of three consecutive nucleotides in themiddle of the coding sequence.4. Substitution of one nucleotide for another in themiddle of the coding sequence.