Concept explainers
Suppose a triplet on the template strand of a piece of DNA has the sequence 5′-ATA-3′. What would be the consequences if the sequence were mutated to GTA? TTA? GCA? Explain your answer in each case.
To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA.
Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.
Explanation of Solution
When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GTA, it will lead to the formation of messenger RNA having triplet codons UAC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAC will code for amino acid tyrosine similar to UAU because of both UAU and UAC code for amino acid tyrosine.
(b)
To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA.
Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.
Explanation of Solution
When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to TTA, it will lead to the formation of messenger RNA having triplet codons UAA in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UAA will code for stop codon instead of tyrosine that would be coded by UAU.
(c)
To determine: The consequences if a sequence 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA.
Introduction: The specific sequences which are present on template strand of DNA (Deoxyribose nucleic acid) in the form of triplet codons will transmit the information for the formation of messenger RNA (Ribose nucleic acid) and proteins.
Explanation of Solution
When a sequence of 5ʹ-ATA-3ʹ on template strand of DNA has been mutated to GCA, it will lead to the formation of messenger RNA having triplet codons UGC in 3' to 5' direction. It occurs because if ATA was present, the resulting messenger RNA would be UAU. Therefore, due to the mutation, UGC will code for amino acid cysteine instead of tyrosine that would be coded by UAU.
Want to see more full solutions like this?
Chapter 18 Solutions
Becker's World of the Cell (9th Edition)
- Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?arrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forward
- Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′arrow_forwardConsider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardIn the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forward
- The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forwardIn relation to central dogma of molecular biology answer the following questions: The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect.arrow_forwardConsider the expression “central dogma,” which refers to the flow of genetic information from DNA to RNA to protein. is the word “dogma” appropriate in this context?arrow_forward
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardWould a gain of function mutaion that occurs in the first exon of a gene with twelve exons more likely be missense or nonsense? Briefly explain your choice. List one disease that we studied in class that is due to a gain of function.arrow_forwardThe restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education