Concept explainers
CASE STUDY |A mysterious muscular dystrophy
A man in his early 30s suddenly developed weakness in his hands and neck, followed a few weeks later by burning muscle pain–all symptoms of late-onset muscular dystrophy. His internist ordered genetic tests to determine whether he had one of the inherited muscular dystrophies, focusing on Becker muscular dystrophy, myotonic dystrophy Type I, and myotonic dystrophy Type II. These tests were designed to detect mutations in the related dystrophin, DMPK, and ZNF9 genes. The testing ruled out Becker muscular dystrophy. While awaiting the results of the DMPK and ZNF9 gene tests, the internist explained that the possible mutations were due to expanded tri- and tetranucleotide repeats, but not in the protein-coding portion of the genes. She went on to say that the resulting disorders were due not to changes in the encoded proteins, which appear to be normal, but instead to altered RNA splicing patterns, whereby the RNA splicing remnants containing the
What is alternative splicing, where does it occur, and how could disrupting it affect the expression of the affected gene(s)?
Case summary:
A man experiences all the symptoms of late-onset muscular dystrophy including weakness in neck and hands and burning muscle pain. He has been prescribed several tests to detect mutations out of them Becker muscular dystrophy ruled out, results waited for DMPK and ZNF9 gene tests, so possible mutations were due to tri- and tetranucleotide repeats rather by changes to altered ribonucleotide acid (RNA) splicing patterns.
He has undergone different genetic tests to detect mutations in ZNF9, dystrophin, and DMPK.
Internist said that the disorder is due to changes in RNA splicing patterns and not in the protein-coding portions of the genes as the proteins appear to be normal.
Characters in the case:
A man with the symptoms of muscular dystrophy.
Adequate information:
Gene tests are the test to diagnose changes in chromosomal genes or proteins. These are mainly for abnormal chromosome number and mutations, which lead to inherited or rare disorder.
To determine:
Definition of alternative splicing and its occurrence, and the effects on expression of affected genes if it is disrupted.
Explanation of Solution
Given information:
A man with symptoms like muscular pain and weakness in hands and neck. Genetic test reveals Becker muscular dystrophy in this case, which is associated with the alteration in RNA splicing.
Alternate splicing also called as deferential splicing is the process occurs during gene expression resulting in different forms of mRNA from the identical pre-mRNA molecules, so we can say expression of a single gene leads to the formation of multiple proteins. In this process, the particular exons of a gene may be included or excluded from the final product of processed RNA. Resulting in changes in amino acids sequences and in there functioning. It occurs in spliceosome after the pre-mRNA has been transcribed.
Disruption in RNA processing can lead to miss-splicing of multiple transcripts, while alterations at single nucleotide lead to differences in single genes and thus in final product mRNA from a mutated gene. In case of muscular dystrophy, there is no change is recorded in protein products while the main cause is the accumulation of RNA in the nucleus, which have the toxic effects on the cells.
Hence, it can be concluded that Alternate splicing is a regulatory mechanism in eukaryotes, which removes or adds exons in the pre-mRNA polypeptide. However, alterations in these mechanisms lead to many inherited disorders because it will change the amino acid sequence and genes functioning.
Want to see more full solutions like this?
Chapter 15 Solutions
Essentials of Genetics (9th Edition) - Standalone book
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.arrow_forwardQuestion : Give an alternative form of CpG methylation, given clear handwritten explaination!arrow_forward15-2. Explain whether the following statements are true or false.Justify the false ones.A. Ribosomes are the cytoplasmic structures that duringProtein synthesis is linked by an mRNA moleculeforming polyribosomes.B. The Leu-His-Arg-Leu-Asp-Ala-Gln-Ser- Amino Acid SequenceLys-Leu-Ser-Ser is a signal sequence that directs proteinsinto the endoplasmic reticulum.C. All transport vesicles in the cell must have av-SNARE protein in its membrane.D. The transport vesicles carry protein and lipid to thecell surface.E. If the delivery or distribution of lysosomal proteinsprospects from the trans-Glogii network to endosomes areblock, lysosomal proteins would be secreted by pathwaysof constitutive secretion like those in Figure 15-28.F. Lysosomes digest only substances that have been takenby cells by endocytosis. 15.3 Many of the proteins produced in the reticulumendoplasmic changes such as the addition ofcarbohydrates (oligosaccharides). What is the function of thesesugars in such proteins? 15.4…arrow_forward
- PLEASE ANSWER ALL OF THEM. THEY ARE ALL CONNECTED MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA. 1.. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 2. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 3. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 4. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 5. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)arrow_forwardTalk about the challenges involved in determining the genetic components of polygenic illnesses. Explain complementation groups and how the biochemical underpinnings of disease are determined using them. Hereditary illnesses of genomic instability include Werner syndrome, Bloom syndrome, XP, ataxia-telangiectasia, and Fanconi anemia. Which of these ailments has molecular mechanisms behind it? Which kind of genetic instability is connected to which disorder?.arrow_forwardMCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.arrow_forward
- a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Can you be sure?arrow_forwardLS1-1 Which of the following can you conclude about the hemoglobin in individuals with sickle cell anemia? Choose two answers that apply. O The amino acids sequenced for the abnormal hemoglobin replaced a Glucine (Glu) for a Leucine (Leu). The amino acids sequenced for the abnormal hemoglobin was the same as it was for the normal hemoglobin. There was an error in the transcription from DNA to RNA. O The amino acids sequenced for the abnormal hemoglobin replaced a Glucine (Glu) for a Valine (Val). There was an error in the nucleotide sequence in the original DNA strand.arrow_forwardQuestion:- 7. Describe how the Polycomb group proteins influence genome expression.arrow_forward
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardplz choose incorrect option . Q. Telomere is a typical heterochromatic region in eukaryotic genome. Choose an incorrect description about gene silencing in telomere. ① Methylation on H3K9 is an initiating event for heterochromatin formation in telomere ② Mutation of Rap1 will disrupt the heterochromatic formation in telomere ③ Region of heterochromatin can spread along the chromosome until inhibiting mechanisms stop it ④ Sir complex is the key factor that condenses nucleosome in telomerearrow_forward1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education