Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 14.3, Problem 1COMQ
When tryptophan binds to trp repressor, this causes trp repressor to __________ to the
operator and ________ transcription.
a. bind, inhibit
b. not bind, inhibit
c. bind, activate
d. not bind, activate
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A mutation in Ras that prevents Ras from hydrolyzing GTP.
Would cause? Why?
A. Increased proliferation
B. Decreased proliferation
Ligand-activated receptors should be ________ before they can bind DNA and activate transcription.
a. dephosphorylated
b. phosphorylated
c. bound by their metabolite ligand
d. bound by their hormone ligand
As trytophan levels increase in the cell, _____ bind(s) to active aporepressors, causing ______ of tryptophan operon.
a.
inducers, negative regulation
b.
repressors, co-repressing
c.
tryptophan, negative regulation
d.
tryptophan, positive regulation
e.
B-lactose, negative regulation
Chapter 14 Solutions
Genetics: Analysis and Principles
Ch. 14.1 - 1. A repressor is a __________ that _________...Ch. 14.1 - 2. Which of the following combinations will cause...Ch. 14.2 - 1. What is an operon?
a. A site in the DNA where...Ch. 14.2 - The binding of _______ to lac repressor causes lac...Ch. 14.2 - Prob. 3COMQCh. 14.2 - How does exposing an E. coli cell to glucose...Ch. 14.3 - When tryptophan binds to trp repressor, this...Ch. 14.3 - During attenuation, when tryptophan levels are...Ch. 14.3 - Operons involved with the biosynthesis of...Ch. 14.4 - 1. Translation can be regulated by
a....
Ch. 14.4 - Prob. 2COMQCh. 14.5 - 1. For a riboswitch that controls transcription,...Ch. 14 - 1. What is the difference between a constitutive...Ch. 14 - In general, why is it important to regulate genes?...Ch. 14 - Prob. 3CONQCh. 14 - Transcriptional regulation often involves a...Ch. 14 - An operon is repressible-a small effector molecule...Ch. 14 - Prob. 6CONQCh. 14 - 7. What is enzyme adaptation? From a genetic point...Ch. 14 - Prob. 8CONQCh. 14 - Prob. 9CONQCh. 14 - Prob. 10CONQCh. 14 - Mutations may have an effect on the expression of...Ch. 14 - 12. Would a mutation that inactivated lac...Ch. 14 - Prob. 13CONQCh. 14 - 14. As shown in Figure 14.12, four regions within...Ch. 14 - 15. As described in Chapter 13, enzymes known as...Ch. 14 - 16. The combination of a 3–4 stem-loop and a...Ch. 14 - 17. Mutations in tRNA genes can create tRNAs that...Ch. 14 - Prob. 18CONQCh. 14 - Prob. 19CONQCh. 14 - A species of bacteria can synthesize the amino...Ch. 14 - 21. Using three examples, describe how allosteric...Ch. 14 - How are the actions of lac repressor and trp...Ch. 14 - 23. Transcriptional repressor proteins (e.g., lac...Ch. 14 - Answer the following questions that pertain to the...Ch. 14 - Chapter 21 describes a blotting method known as...Ch. 14 - As described in experimental question E2 and also...Ch. 14 - Prob. 4EQCh. 14 - Explain how the data shown in Figure 14.9 indicate...Ch. 14 - Prob. 6EQCh. 14 - Lets suppose you have isolated a mutant strain of...Ch. 14 - Prob. 1QSDCCh. 14 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A particular drug inhibits the protein kinase that is responsible for phosphorylating the CREB protein. How would this drug affect the following events? A. The ability of the CREB protein to bind to CREs B. The ability of extracellular hormones to enhance cAMP levels C. The ability of the CREB protein to stimulate transcription D. The ability of the CREB protein to dimerizearrow_forwardThe genes encoding the proteins involved in photosynthetis are activated and their mRNAs are made only when the plants are exposed to light. This is an example of ___ regulation. A. post translational level B. long term transcriptional level C. short term transcriptional level D. translational level E. post transcriptional levelarrow_forwardWhich of these is used in the transcription of all genes? Choose all correct answers. A. Core promoter B. Proximal promoter C. Distal promoter D. General Transcription Factors E. Regulatory Transcription Factorsarrow_forward
- Lipid-soluble signaling molecules, such as testosterone, cross the membrane of all cells but only affect target cells because a. intracellular receptors are only present in target cells b. only target cells possess the cytosolic enzymes that transduce the testosterone c. target cells are the only cells that can initiate the phosphorylation cascade leading to the transcription factor d. only target cells retain the appropriate DNA segmentsarrow_forwardWhich statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairarrow_forwardA repressor is a __________ that _________ transcription. a. small effector molecule, inhibits b. small effector molecule, enhances c. regulatory protein, inhibits d. regulatory protein, enhancesarrow_forward
- Which of the following consequences of mutations would likely to be associated with an increased cancer risk? (select all that apply)? A. Truncation of the EGF receptor B. Constitutive activation of K-Ras C. Amplification of myc D. Truncation of H-Ras due to a premature stop codon E. Amplification of ErbB2arrow_forwardSelect one: and p53 is a a transcription factor, motor protein b. kinase, motor protein c. transcription factor, kinase d. motor protein, transcription factor e. motor protein, protease f. kinase, transcription factorarrow_forwardA transcription factor (protein - orange/green) is bound to a promoter of a gene (DNA - blue) it regulates. What changes would result in the gene not being expressed? A. Mutations in the DNA sequence where the TF is bound B. Mutations in the DNA binding domain of the TF C. Mutations in the 3’UTR (untranslated region) of this gene A and B only B and C only A, B, and Carrow_forward
- in E.coli, high glucose levels reduce cyclic AMP (cAMP) levels which then ______ transcription of the lactose operon. a. does NOT change b. decreases c. increasesarrow_forwardDuring attenuation, when tryptophan levels are high, the ________ stem-loop forms and transcription _________ the trpL gene. a. 1–2, ends just past b. 3–4, ends just past c. 1–2, continues beyond d. 3–4, continues beyondarrow_forwardSrc/LcK is a cancer-associated kinase. a. Name the domains that constitute this protein and give the function of each one. b. Define a domain and state the difference between domain and motifarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY