Which of the following statements about gluconeogenesis is TRUE? Gluconeogenesis is one way to maintain blood glucose levels between meals. O Gluconeogenesis converts fatty acids into glucose. O Gluconeogenesis is activated by the hormone insulin. O Gluconeogenesis reduces blood glucose levels after a carbohydrate-rich meal.
Q: 1- Catalyzes the production of FADH, in the Krebs cycle: a) isocitrate dehydrogenase b) aconitase c)…
A: The acetyl CoA molecules that are synthesized as the end product of carbohydrate, protein, and lipid…
Q: 2. What molecule does not bind to hemoglobin? O (a) Carbon monoxide (CO) O (b)…
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: Provide 6 reactions that facilitate the synthesis of oxaloacetate
A: Introduction Oxaloacetic acid in the form of oxaloacetate is a metabolic intermediate in many…
Q: a) Determine kcat (in units of sec-1) for a particular enzyme, given the following information: Vo =…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Electron transport chain. Complex 2
A: Electron transport is a succession of redox reactions, much like a relay race. It is a component of…
Q: Mechanism of action of electron transport inhibitors. Amital.
A: INTRODUCTION : First of all, there is no electron transport inhibitor called Amital, it is a wrong…
Q: true/false: Humans produce isoleucine using pyruvate as a starting material.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 1. Determine the molecular properties of amino acids; - what happens to the protein folding pattern…
A: "Since you have asked multiple questions, we will solve the first two questions for you. If you want…
Q: Denatured protein is in a low energy state. What sort of explanation can you use to rationalize that…
A: Denaturation of protein: When proteins are denaturized, they lose the quaternary, tertiary, and…
Q: Make a summary
A: Glucagon is a peptide hormone secreted by the pancreas in response to low blood glucose levels.…
Q: Calculate the number of moles of ATP produced from the complete oxidation of 900 g glucose in the…
A: Glucose that enters the cell produces ATP by respiration. The processes involved are glycolysis,…
Q: 1. Comparative characteristics of glycogen metabolism in muscles and liver.
A: Metabolism is consist of both catabolic (breakdown) and anabolic (synthesis) processes. Glycogen is…
Q: Draw the structure of the following: (in the image provided) Use the amino acids below. F -…
A: Recall that: Amino acids have an amino group, a carboxyl group and a side linked to the same carbon…
Q: The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase…
A: Replication, transcription, translation are the three processes of central dogma of life.…
Q: Symport and antiport proteins must be active transport proteins A)True B)False
A: The biological membranes are selectively permeable. Transport across the biological membrane can be…
Q: Which of the following is TRUE? Both AMP and ADP are negative regulators of glycogenolysis. O ATP…
A: Glycolysis is the catabolic pathway in which glucose is broken down into pyruvate that enters TCA…
Q: Choose all of the true statements about oxidative phosphorylation. Oxidative phosphorylation occurs…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: Are there anymore features that limit the protein configurations?
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: Given a peptide chain that is composed of the following amino acids: (branched chain-- polar…
A: Chromatography is a separation technique by which amino acids dissolved in a mobile phase are…
Q: What do you call the test used to detect the presence of protein in saliva?
A: Proteins are high molecular weight biomolecules. They are polymers of amino acid residues linked to…
Q: The oxidized form of NADH is O NADH+ O NAD+ O NADOH O NADH2 -
A: Metabolism involves the use of many redox reactions. In redox reactions, electrons can either reduce…
Q: Consider the two half-reactions below and their standard reduction potentials. NAD+ + H+ + 2e → NADH…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the full cream milk is composed of ~54.5%…
Q: in a specrophotometry ethanol determination experiment, you measured OD340 and assumed this…
A: Nicotinamide adenine dinucleotide: The molecules nicotinamide adenine dinucleotide (NAD) and…
Q: Reaction of alkaline, acid and enzymatic hydrolysis of triacylglycerols.
A: Triacyl glycerols are triglycerides which are formed from 3 molecules of fatty acids and one…
Q: OOC 1 H₂C H₂C H₂C-C HC H₂C NH NO HN Coo 1 CH₂ T CH₂ C-CH, CH C-CH₂ G=CH₂ "OOC 1 H₂C H₂C T H₂C H₂C-C…
A: Hemoglobin has four subunits, in which each has a heme group. The heme group is a heterocyclic…
Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…
A: Gene regulation is the process of control of expression genes. This process occurs by several…
Q: Choose the correct answer from the options in brackets. The [positive/negative] standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: What could be seen in the organic acid precipitation during the protein denaturation experiment if…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: human cannot digest stachyose. Why?isn‘t it true that human do have aplpha galactosidase to break…
A: Some carbohydrates cannot be broken down in the small intestine by human enzymes. Raffinose and…
Q: Calculate protein concentration in unknown samples 1, 2, 3: Absorbance of Unknown 1 = 0.541…
A: Given that the standard BSA concentration is 1mg/mL. 10, 20, 30 ,40 and 50 µL of the standard BSA…
Q: 2. Complete the following for serine, tyrosine, and gylcine. a. Draw the amino acid. b. Circle the…
A: Amino acids are the building blocks of proteins. they can be classified into different groups based…
Q: 1. Explain why lipids are insoluble in polar solvents. 2. How do oils and fats differ?
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: Introduction: An antagonist is a substance that does not cause any biological response itself but…
Q: 1. Draw (or insert) the general formula of an amino acid and label the four components. Which one…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question for…
Q: n oil obtained from salmon is unusual in that all three fatty acid components are identical. The…
A: Introduction Lipid is one of the important biomolecule in our body. Lipid is present in the plasma…
Q: Please answer both Note :- Other wise down vote.
A: The reactions that involve biomolecules are called biochemical reactions. These occur inside the…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: Show a calculation of change in standard reduction potential that explains why succinate is not…
A: When two half reactions are paired in a redox reaction, the half reaction with the higher E°' will…
Q: Can human digest this trisaccharide?What bond is it between sugar B and sugar C?(be specific)
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: A plot of enzyme activity with and without an inhibitor present gave the following. Use two…
A: The rates of biochemical reactions are increased by proteins known as enzymes. Inhibitors are…
Q: How much ATP will be produced from the Beta-oxidation of lauric acid a C 12 saturated fatty acid?…
A: Lauric acid is a saturated fatty acid with 12 carbon atoms. The molecular formula of lauric acid is…
Q: What is the committed step of pyrimidine biosynthesis? Include the names and structures of any…
A: Pyrimidines are nitrogenous bases found in nucleic acids. Pyrimidines are heterocyclic organic…
Q: 5. Thin layer chromatography separates lipids in the following order: hydroxylated lipids, then…
A: The working principle of thin-layer chromatography is the same as column chromatography. A small…
Q: Xylulose and ribulose are epimer pairs. Please explain why and how to identify epimer pairs
A: Epimers are the simple Sugars that differ in a single chiral centre or in the arrangement of OH…
Q: What are the units for KM and why does this constant have these units? In the Michaelis-Menten…
A: The general equation for initial velocity (V) of a reaction involving a single substrate on an…
Q: Make a Concept Map about the Amino Acids. Separate them base on Essential, Non-Essential, and…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Glucose and fructose are monosaccharides. Glucose is an aldose sugar and fructose is a ketose sugar.…
Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…
A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- _________lowers blood sugar levels; ____________ raises the level of blood sugar. a. Glucagon; insulin b. Insulin; glucagon c. Gastrin; insulin d. Gastrin; glucagonWhich of the following statements about gluconeogenesis is correct? * Muscles have a large glycogen store which gives rise to blood glucose during prolonged starvation Fatty acids are plentiful in the blood during starvation and are used for glucose synthesis The enzyme glucose-6-phosphatase hydrolyses glucose-6-phosphate and is present in most cells. Gluconeogenesis enables the liver O to maintain blood glucose levels during starvationWhich of the following statements about gluconeogenesis is TRUE? Gluconeogenesis is one way to maintain blood glucose levels between meals. Gluconeogenesis converts fatty acids into glucose. Gluconeogenesis is activated by the hormone insulin. Gluconeogenesis reduces blood glucose levels after a carbohydrate-rich meal.
- In gluconeogenesis, how is glucose-6-phosphate converted to glucose? is converted to glucose by glucose-6-phosphatase. is converted to glucose by pyruvate kinase. is converted to glucose by hexokinase. is first converted to dihydroxyacetone phosphate before Glucose-6-phosphate Glucose-6-phosphate Glucose-6-phosphate Glucose-6-phosphate being converted to glucose.The body doesn’t have a reserve of proteins or amino acids for energy production. Which class of protein may be used initially during fasting to maintain glucose and energy levels? What is the difference between a glucogenic and ketogenic amino acid and why are both important during fasting?Its principal function is to increase the concentration of glucose in the blood by speeding the glycogenolysis and gluconeogenesis in the liver.
- Glucose can be made from oxaloacetate during gluconeogenesis, but if oxaloacetate concentrations are decreased,what other substance can be used to make glucose? How might this contribute to increased fat loss?Which of the following statements about the ketone bodies is/are TRUE? Produced during starvation and in diabetic patients Excess is transformed to acetone or hydroxybutyrate. Extreme amount of ketone bodies may cause ketosis in diabetics. Occurs during a high-lipid and low-protein diet.you follow a carbohydrate-free diet, certain metabolic problems occur. Describe glucogenesis and the problems that may arise from this prolonged glucogenesis state.
- Metabolic ketoacidosis is a common problem with diabetics, which is caused by which of the following? Excessive oxidation of fatty acids, leading to an accumulation of ketone bodies in the blood. Excessive oxidation of glucose, leading to an accumulation of ketone bodies in the blood. Excessive oxidation of proteins, leading to an accumulation of ammonia in the blood. Hyperglycemia.Which of the following statements regarding gluconeogenesis is NOT true: It utilizes all of the same enzymes as glycolysis. It results in production of glucose from pyruvate. It consumes ATP. It involves one or more intermediates that are different from those of glycolysis.A deficiency in which of the following B vitamins would result in symptoms similar to those seen in glycogen storage disorders such as McArdle Disease and Hers Disease? OPyridoxine (B6) Biotin (B7) Folic Acid (B9) Cobalamin (B12) all of the above