Which of the following base pairings is correct for RNA? A) U and T B) G and T C) C and U D) C and A E) A and U
Q: Calculate the %fat contribution of the fat from the kebab to his daily energy needs. 1 If 100g of…
A: The most basic requirement of the body is energy. Kilocalories (commonly abbreviated to "calories")…
Q: What is the event that ends the first stage of glycolysis? synthesis of NADH synthesis of…
A: Glycolysis is the first step of oxidation in glucose metabolism in which glucose is converted to…
Q: When the amino acid sequence of Hb and Mb is compared, some of them are found to be the same…
A: Hemoglobin and myoglobin are oxygen binding proteins. Hemoglobin helps to carry oxygen from lungs to…
Q: How does a change in pH affect the structural levels of a protein?
A: Tertiary structure of a protein is stabilized by disulfide bonds, hydrogen bonds, hydrophobic…
Q: You have a solution with the mixture of the following peptides: 1) Wing-Cys-Gly 2)phe-tyr-trp-phe…
A: Proteins or polypeptides are made up of chain of amino acids. The name itself indicates that an…
Q: Which of the following statements is true about active transport? A. The transported species always…
A: Active transport is a mode of transport of molecules against the concentration gradient using…
Q: An important protein in contractile muscle. OA. keratin O B. myosin O c. elastin OD. fibrin
A: The proteins have a variety of functions in the body. The functions of the proteins in the body are…
Q: IFs, provide very little mechanical strength to cells. How can you rebut this and provide…
A: Introduction : Intermediate filaments constitute the cytoskeleton, which provides mechanical support…
Q: create a unique biosynthesis pathway of mevalonic acid from Geranyl to cardiac and saponin…
A: Examples of terpenes are saponins, gutta, rubber, cardenolides, pyrethrin, etc. Based on the…
Q: H₂N-CH CH₂ CH₂ + H₂O NAD+ NADH + H+ 9 =0 O=C CH₂ CH₂ + NH₂+
A: The enzyme commission has given the name for each enzyme in addition to their trivial names. It…
Q: What carbohydrate is generally detected using the Molisch test?* A. Monosaccharide B. Disaccharide…
A: Carbohydrates or sugars are the most abundant biopolymers in living organisms. Carbohydrates are…
Q: hoose the conditions when PDH is activated. a) acetyl CoA/CoA ratio is high b) NAD+/NADH ratio is…
A: PDH is a regulatory enzyme situated in inner mitrochondrial membrane which is comprise of three…
Q: Which of the following statements best describe testing of lactose sample?* A. Lactose will…
A: Lactose is a reducing disaccharide . It is formed as β-D-galactose forms a 1,4 glycosidic bond with…
Q: Interpret the figure to explain how histidine and aspartate make serine a better nucleophile. a.)…
A: The figure shows catalytic traid of serine protease mechanism and how protons are transferred by…
Q: The enzyme lysozyme catalyses the hydrolysis of the polymer that consists of N-acetylglucosamine…
A: A polymer made of N-acetyl muramic acid and N-acetyl glucosamine (NAM and NAG) residues consist of…
Q: Which is more hydrophilic, cholesterol or phospholipids? Defend your answer
A: Organic substances known as lipids are not water soluble. They are non-polar and are soluble in…
Q: struggling help
A: Biomolecules are important for constituting the biomass of living organisms. There are four…
Q: Which method in biotechnology is used to read and understand an organism's DNA?
A: DNA is a nucleic acid that acts as the genetic material. Knowledge of sequence of an organism's DNA…
Q: What metabolic structure is produced from the carbon atoms of each of the following amino acids?…
A: Metabolism of amino acids results in the removal of amino group and entry of the remaining carbon…
Q: 1. Which expression below shows hemoglobin bound to a proton a. HbH+ b. HbO₂H+ c. HbBPG d. None of…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Given the following reactions, identify the class and subclass of the enzyme involved
A: The enzyme commission divided enzymes into six different classes. This classification if carried out…
Q: For the following tetrapeptide: CKSW a. Draw its complete protonic equilibria. Indicate the net…
A: Note that the tetrapeptide has 4 side chains, sulfydryl, amino, hydroxyl and a secondary amine. The…
Q: The sequences of four DNA molecules are given bel ii. TTTCCCGGGAAA AAAGGGCCCTTT iv. GCCGGATCCGGC…
A: DNA molecules are the nucleic acids that contain sugar, phosphate and nitrogenous base. Sugar is…
Q: The vitamin that facilitates iron absorption.* A. B9 B. B12 C. C D. A
A: The duodenum and proximal jejunum are where the majority of dietary iron is absorbed, and this…
Q: 2. | Calculate the overall charge (pH 7) on the following three polypeptides and answer the…
A: Proteins or peptides are composed of twenty standard amino acids that differ from each other on the…
Q: In oxidative phosphorylation, how many molecules of ATP are produced per molecule of NADH in the…
A: The electron transport chain and chemiosmosis are two parts of oxidative phosphorylation that are…
Q: Glucose molecules produced during photosynthesis contain higher levels of carbon-12 than carbon -13…
A: In nature, two stable isotopes of carbon exist, carbon 12 and carbon 13. Carbon 13 has one extra…
Q: The following carbohydrates are disaccharide, except:* A. Maltose B. Galactose C. Lactose D.…
A: Carbohydrates are the primary building blocks of all living organisms. Carbohydrates are all made up…
Q: lactate 0 NAD+ НО 0 НО ОН он н О ОН N NH₂ NH₂ lactate dehydrogenase НО H- НО он н 0 ОН H H+ pyruvate…
A: The lactate dehydrogenase carries out the reversible conversion of pyruvate to lactate along with…
Q: Which of the following is incorrect about enzyme inhibitors? a. They can be reversible or…
A: Aspirin irreversibly inhibits the COX-1 enzyme. It covalently modifies this enzyme and is used to…
Q: Which of the following statements about genes are correct? A gene is a region of a DNA strand that…
A: DNA is called deoxyribonucleic acid. DNA is also called the genetic material. DNA is composed of…
Q: A competitive inhibitor binds to the - active site of theenzyme - a substrate -N termininus of…
A: Introduction: The inhibition of enzyme activity is of two type -irreversible and reversible…
Q: 2 ways that kinases can become resistant to kinase inhibitors? in trace of polyethylene melting it…
A: Kinases are enzymes that catalyze the transfer of gamma phosphate group from ATP to the serine,…
Q: A biological molecule is shown here. What is the most likely classification of this molecule? HO…
A: The four classes of biological macromolecules are nucleic acids, carbohydrates proteins and lipids.…
Q: what is the relationship of adding protein with a meal that contains simple carbohydrates with…
A: Diet is the amount of a particular combination of food that we take during the day. Diet contains…
Q: Which of the following is incorrect about the rate of an enzyme-catalyzed reaction? O a. It does not…
A: The rate of an enzyme-catalyzed reaction depends on certain factors and one of them is concentration…
Q: What the term "hydrophilic" means in simple terms. explain the answer with exmaples and answer…
A: Molecules are classified as hydrophilic and hydrophobic based on their solubility in water.…
Q: Explain, which site of the heme structure, A or B, is this prosthetic group plugged into the core…
A: Myoglobin is an oxygen-binding globin protein found mainly in the muscles of almost all mammals. It…
Q: QUESTION 3 Strands of DNA join together with Hydrogen bonds. These bonds form between the…
A: In double stranded DNA the two strands of DNA are twisted around one another in the form of a…
Q: A mixed triglyceride contains: O A. three similar fatty acids esterified with glycerol B. two…
A: Triglycerides are lipids containing three fatty acids each in ester linkage with a glycerol moiety.
Q: Question 7 A sample was methylated and then digested, yielding a of 2,3-dimethylglucose and…
A: Glucose is a carbohydrate and it acts as the primary energy source for cells. Carbohydrates are…
Q: We are outnumbered by the bacteria in our colon. Why don't they typically make us sick? a) They…
A: The human microbiome helps to maintain the intestine linings and prevents the growth of pathogenic…
Q: In the synthesis of 1 mole 1-lauroyl-2-myristoyl glycerol, the number of moles of water released is?…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Which of the following statements is not true about enzymes?*
A: Enzymes are usually composed of proteins and it works as a catalyst to speed up the biochemical…
Q: I just read an abstract of the paper “Disulfide bond-disrupting agents activate the tumor necrosis…
A: The TNF or Tumour Necrosis Factor receptors are Cysteine Rich Domain (CRD) containing Receptors. It…
Q: make your own timeline on biochemistry development up to 2022
A: Biochemistry is the study of biochemical reactions and biological process by applying the knowledge…
Q: Why we called the blood urea nitrogen not serum urea, although we called the serum creatinine??
A: A Blood urea and serum creatinine test is two different tests are done to check the kidneys…
Q: An enzyme catalysed reaction has a Km of 8 mM and a Vmax of 13 nM.s-1. Use the Michaelis-Menten…
A:
Q: What is the building block of proteins?* A. Carboxylic acid B. Amino acid C. Hydrochloric acid D.…
A: Biomolecules are organic compounds produced by living organisms. They play important function as…
Q: Integral membrane proteins can exist as all of the following, except: a. A single helix A beta…
A: An integral or intrinsic membrane protein abbreviated as IMP is one type of membrane protein that is…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)1) It is declared that some ribozymes are tightly bound to proteins. What isn't the function of those proteins? Select one: A) Regulate the enzymatic activities of the ribozyme B) Conduct the enzymatic function of the ribozyme C) Help the RNA fold properly D) Stabilize the RNA and the ribozyme 2) What promotes the histone chaperone - CAF-I aggregation to the replication machinery? Select one: A) Nucleosome tall modification B) sliding DNA clamp C) Clamp Loader D) DNA polymeraseACUGACUGA Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): AUG-AGU-GGG-UGU Gly Phe Leu (F) (L) Glu Ser Asp (E) (D) (S) AGU C Tyr (Y) Ala AGU (A) A Val Cys (C) G U (V) C G A 34 Trp (W)3 G G Arg (R) U AG A C C Leu Ser (S) U (L) A C G. A Lys (K) CUG A Pro Asn (N) CUGACU G (P) His Thr Gln (H) (Q) Arg (R) Start Stop Your answer Met (M)O
- Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1, AA2, and AA3 so that the parallel B-sheet is amphipathic and remains stable. Glu-lle-Asn-AA1-Cys-Val Ser-AA2-GIn-Leu-Lys-Phe Lys-Met-Cys-Leu-AA3-Val O AA1 = Pro, AA2 = Leu, AA3 = lle O AA1 = Val, AA2 = Leu, AA3 = Asn O AA1 = Ala, AA2 = Gly, AA3 = Leu AA1 = Phe, AA2 = Arg, AA3 = Ala O Othe chemical group responsible for nucleophilic attack in translational elongation is a) free alpha-NH2 group on amino acid of A site aminocyal tRNA b) the 3=hydroxyl on the 3' end ribose c) the oxygen on the alpha phosphate of the incoming NTP d) the 5= hydroxyl on the 5' end deoxyribose e) an oxyanion on the Y-phosphate of the dNTPLike a helices, ß sheets often have one side facing the surface of the protein and one side facing the interior, giving rise to an amphiphilic sheet with one hydrophobic surface and one hydrophilic surface. From the sequences listed below, pick the one that could form a strand in an amphiphilic ß sheet. O TLNISFQMELDV O DSETKNAVFLIL O VLEFMDIASVLD
- a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
- Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letterN-linked glycoproteins are glycosylated co-translationally at which consensussequence? A) Asn-X-Ser B) Met -Gly -X-Asn -X-Ser C) no specific sequence D) Ser- Asn -Thr E) Cys- X-AsConsidering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'