Answered: What is the mRNA transcribed by the…

Name: What is the mRNA transcribed by the following piece of DNA? Make sure
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What is the mRNA transcribed by the following piece of DNA? Make sure to label its directionality. Then write the sequence of the lagging strand in replication of the below strand.ATTCCGAGTCAAGAA

Science

Biochemistry

What is the mRNA transcribed by the following piece of DNA? Make sure to label its directionality. Then write the sequence of the lagging strand in replication of the below strand. ATTCCGAGTCAAGAA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
The following DNA sequence occurs as the template strand: 3’ – TACGGGGATCAGATTATC – 5’ DNA template What single nucleotide deletion within the DNA sequence would cause a frame shift and a premature STOP codon? Write down the sequence of the New DNA template after deletion of the single nucleotide and also that of the New mRNA transcript, and specify the 5’ and 3’ ends of both the template and the mRNA transcript. Highlight the premature stop codon in the mRNA transcript.
Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash. Do not put a space in between characters so that LMS will recognize your answer. Message Strand +1 5-TAGTAGGCGGCATGTTTTCCCATACAGATGAAGGATAAACTCGTCT[x]TAT-3' [x]-cleavage site for CFI/CFII endonuclease (for RNA) Genetic Code: Second letter с A G UAUTyr UGC Cys UAC. UAA Stop UGA Stop UAG Stop UGG Trp CAUT CGU CAC His CGC CAA CGA Arg Gin CAGJ CGG AAU Asn AGU Ser AAC. AGC AAA AGA AAG Lys AGG Arg GAU GGU Asp GACJ GGC GAA GGA Glu GAGJ GGG] First letter כ A G U UUU UUC UUA UUGL CUU CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC Val GUA GUG Phe Leu Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Gly DUAU DUAU DURO DURO A G Third letter
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & III
This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the strand (which one?) . Show the RNA sequence from 5’ to 3’ direction. Then translate the RNA sequence into protein sequence using the genetic code table. 5’AGGGTCCAC 3’
Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?