Show an ionic bond between the histone and a DNA strand on the cartoon: histone protein NH3 NH3 H3N- -NH3 H3N- -NH3 HgN Would this binding depend on the sequence of base pairs in DNA? NH3 O NH3
Q: Nucleosomes are the ball-like structures around which the double helix winds. What proteins make up…
A:
Q: True or False 1. Histone proteins are able to associate with DNA segments because of the anionic…
A: Nucleic acid: It was first discovered by " Friedrich Miescher", from the pus cells nuclei . Nucleic…
Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…
A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…
Q: Which of the following statement O It enables RNA polymerase to bind to the DNA O It is rarely found…
A: Histone deacetylase is a category of enzymes that take away acetyl group teams (O=C-CH3) from an…
Q: What's the length of the DNA around histone core in a nucleosome? 50 base pairs 146 base pairs 8…
A: Nucleosome:- Histones are responsible for the first level of DNA packing and most basic level of…
Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…
A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…
Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Central dogma is the process where in the information stored in nucleic acids is transferred to…
Q: What is the diameter of a nucleosome?
A: A nucleosome is the basic formational unit of the DNA packaging in eukaryotic cells. The structure…
Q: A part of a sequenced chromosome has the sequence (on one…
A: DNA is the genetic element in all cell types of prokaryotic and eukaryotic. DNA is double stranded…
Q: Letter 'a' corresponds to 3' 5' 5' 9. 3' 5' parental strands. daughter strands. O leading strand.…
A: Replication fork - It forms inside the long helical of DNA during the process of replication of DNA.…
Q: Describe what structural changes convert a chromosomal region that is 300 nm in diameter to one that…
A: Chromosomes are thread-like structures that are located in the nucleus. It is composed of protein…
Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…
A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA. Missense…
Q: DNA forms a thick fiber that is formed into structural loops. This formation is associated with... O…
A: Introduction: DNA stands for the deoxyribonucleic acid. It is a biomolecule that is composed of two…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: According to Bartleby guidelines only the first question in case of multiple questions have to be…
Q: Kree DNA has histone like proteins that wrap up in nucleosomes. The Kree have a core DNA length of…
A: Nucleosomes are the basic repeating unit of 'beads on a string' structure of eukaryotic chromosome.…
Q: table opposite shows the standard (coding strand et codes for the 20 amino acids involved in protein…
A: DNA is a nucleic acid.
Q: a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What…
A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…
Q: A. Refer to the figure below and explain DNA packaging and Describe 1 structural…
A: DNA is the genetic material of organisms which inherits from generation to generation from parents…
Q: During replication, new nucleosomes assemble on thedaughter DNA molecules. Regulatory proteins bind…
A: DNA replication refers to the process in which two similar DNA molecules are formed from one parent…
Q: Histone proteins contain tail amino acids that are positively charged. Which of the following…
A: DNA is a helical structure that carries the genes or the hereditary units of life. DNA is a…
Q: In a nucleosome, what is the DNA wrapped around? A. mRNA B. Nucleolus protein. C. Ribosomes.…
A: First of all we must understand what is a nucleosome. Nucleosome can be considered as the…
Q: The template strand of a segment of double-helical DNA contains the sequence –…
A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is the genetic…
Q: In chromosomes, doubly-stranded DNA wraps tightly around histone proteins. Think about the structure…
A: DNA It is a biomolecule that carries genetic information and information for the process of protein…
Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…
A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…
Q: . The table opposite shows the standard (coding strand) DNA riplet codes for the 20 amino acids…
A: Introduction The process of synthesis of proteins occurs in two steps which are transcription and…
Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…
A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…
Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…
A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…
Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…
A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…
Q: Neutralizing their positive charges would have which effect on the histone proteins? a. They would…
A: Histones are the proteins molecules that are positively charged, found in eukaryotic cells. The…
Q: The following sequence of DNA is part of the normal, wild-type gene. 5'TAC CGG GAC TTG AGC CGA…
A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…
Q: Which of the following make up a core nucleosome structure? A) about 147 bp of DNA D) A tetramer…
A: INTRODUCTION- Chromosome is made up of histone proteins. These proteins interact with the long DNA…
Q: Histone _______ is not part of the histone octamer, but binds to linker DNA and is responsible for…
A: Histones are a family of basic proteins that associate with DNA in the nucleus and help condense it…
Q: Histones form more accessible chromatin because of Select one: a. Reduced electrostatic attraction…
A: Eukaryotic DNA remain associated with histone proteins and from nucleosome model. It is the…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…
Q: Heterochromatin and Euchromatin Have Which Different Histone modifications
A: Introduction Chromatin fibre can be classified into two types based on the condensation:…
Q: In a nucleosome (histone-DNA structure), the histone is highly positively charged. True O False
A: A nucleosome can be described as the section of DNA which is wrapped around the core of proteins. It…
Q: IK Comans Caselm) are shOwn in the following document: Codon Number Base Sequence of Normal DNA…
A: The base sequence of a normally transcribed strand is given as follows, TAC TCC CTC AAT CTT AAT TTG…
Q: The figure below shows a portion of a B sheet in the interior of a protein. The strands are labeled…
A:
Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…
A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…
Q: Research has revealed that ____________ base pairs of DNA are wrapped ____________ times around a…
A: Introduction Deoxyribonucleic acid, or DNA, is a lengthy molecule that houses our unique genetic…
Q: In the following diagram of DNA replication fork, A is a subunit of DNA polymerase Ill. O b. y…
A: DNA polymerase III is used in the synthesis of Chromosomal DNA. DNA pol III participates in the DNA…
Q: A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance between…
A: Introduction : In the context of genomics, the phrase "double helix" refers to the physical…
Q: Describe the distinguishing features of the solenoid and zigzag models
A: The solenoid and zig-zag model both describe the pattern in which DNA is packed with the help of…
Q: Which of the following histones bind to linker DNA?a) H1b) H2Ac) H2Bd) H3
A: Histones are a family of highly alkaline proteins present in nucleus of eukaryotic cell and they…
Q: What makes up the protein component of nucleosome core (the "bead" that the DNA is wrapped around)?…
A: Given: Need to find the best option among the following five options.
Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Letter 'b' corresponds to 3' 5' 5 3' 5' 3' 3' 5' O leading strand. lagging strand. daughter strands.…
A: DNA replication is a crucial step as name suggests replica of a DNA (two replicas) is formed by…
Q: Which of the following proteins preserves an epigenetic alteration of DNA? O MYOD O Ey O HAT…
A: Introduction Epigenetics is the study of how changes in your environment and behaviour can have an…
Q: With respect to DNA binding motifs and their characteristics choose the correct answer O A. All DNA…
A: DNA-binding domains (DBD) are protein domains that can fold independently. They have at least one…
Answer the two bullet points
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GIf the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterIf DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleThe top side of this figure offers more opportunities (for each base pair) that can lead to highly specific protein-DNA interactions. True or False? Major groove Major groove (a) Major groove Major groove O True N-HI110 O False A NIIH-N Minor groove Adenine-Thymine CH3 0111H-N H₂C OFITH 98 TN- GN-HIIN V-HillO Minor groove Guanine Cytosine Minor groove Thymine-Adenine Hillo C NIH OIH -NG Minor groove Cytosine Guanine
- The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly10:39 E DNA/RNA/PROTEIN SYNTHESIS/M... 18 of 20 A DNA nucleotide is composed of what three parts and are held together by Phosphate, ribose, nitrogenous base and held together by hydrogen bonds Phosphate, deoxyribose and held together by hydrogen bonds Phosphate, ribose and held together by covalent bonds Phosphate, deoxyribose, nitrogenous base and held together by hydrogen bonds Next > IIFirst Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?Complete the complementary strand: mRNA transcription ATTCGAGGCTAA