Process of translation *( Choose True if the statement is correct abourt genetic code and False if otherwise ) includes covalent modification of some proteins participation of rRNA transfer RNA is made from messenger RNA tRNA uses information from mRNA to produce amino acid chains
Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…
A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…
Q: 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter…
A: transcription is the process of formation of mRNA from the DNA sequence Translation is the process…
Q: a. What are the nucleotides of the mRNA from gene Z? b. What are the amino acids encoded by gene Z?…
A: The mRNA is produced from DNA by the process of transcriptions. The initiation of DNA transcription…
Q: Draw the mechanism for 5’ capping of mRNA by the associated enzymes (RNA Triphosphatase, RNA…
A: Capping is done in eukaryotic mRNA to prevent the degradation from nucleases. It also assists in…
Q: During the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves…
A: RNA polymerase moves in the 3' to 5' direction and the RNA strand transcribed comes out in 5' to 3'…
Q: Which is true about eukaryotic cDNA? Choose all that apply. a. it is constructed from mRNA that…
A: Complementary DNA (cDNA) is made from messenger RNA in the laboratory for various purposes. Because…
Q: Post-translational modification of proteins refers to the covalent and enzymatic modification of…
A: The translation is a process by which the proteins are synthesized from the RNA. RNA polymerase and…
Q: Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule…
A: Thank you for the question Answer The Genes code for proteins. These proteins are the workhorse of…
Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…
A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…
Q: Process of translation True False transfer RNA is made from messenger RNA participation of rRNA…
A: Deoxyribonucleic acid (DNA) is the biomolecule that contains genetic information necessary for all…
Q: Which of the following is always true of ribosomes? The small ribosomal subunit is composed of only…
A: Ribosomes are macromolecular machines that perform biological protein synthesis and are found in all…
Q: A. RNA polymerase binds to a gene’s promoter. B. RNA polymerase moves over the gene and unzips the…
A: transcription is the process in which m RNA is formed as directed by the template strand of DNA.
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5'…
A: According to the question, we have to write down the messenger RNA sequence ad the polypeptide chain…
Q: Use the numbers below to indicate the correct order of events (from left to right) during the…
A: Hi, Thanks For Your Question. Answer : Correct Sequence Is 3 4 2 1 5.
Q: Initiation of translation begins when the ____. Ribosomal small subunit binds to the 5’ end of the…
A: Translation is the transformation of the mRNA into its respective protein chain encoded in it. This…
Q: Process of translation *( Choose True if the statement is correct about Process of translation and…
A: DNA or deoxyribonucleic acid is a type of nucleic acid present in the nucleus of the cell. It is the…
Q: GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH…
A: The template strand extends from 3' to 5'. The coding strand, that extends from 5' to 3' in…
Q: Arrange the processes involved from Transcription to Translation. RNA polymerase binds in the…
A: The central dogma is the process through which information from DNA(deoxyribonucleic acid) is…
Q: Which of the following is the definition of a gene? RNA that delivers amino acids to a ribosome…
A: Introduction A nucleoside and a phosphate make up nucleotides, which are organic compounds. They are…
Q: which of the following causes transcription to end? RNA polymerase reaches the terminator RNA…
A: Many processes occur within the cell for its normal functioning. They include replication,…
Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…
A: The genetic material has various components on which the transcriptional and translational machinery…
Q: Put these events in chronological order and explain why (i.e. each process listed). Sigma factor…
A: Transcription is a process of formation of mRNA from DNA. This process is done with the help of RNA…
Q: Fill in the blanks: is the term used to describe the genetic coce because the rules that relate the…
A: The genetic code is a set of rules that determine how the genetic information from four-letter codes…
Q: Why siRNA phenomenon is utilized in cell biology? Because specific gene silencing leads to blocking…
A: short double-stranded RNA again about 21-25 bases, would silence the corresponding geneThe RNA…
Q: Translation of mRNA is terminated at the stop codon by: A. binding of the Release Factor to stop…
A: The translation is the process, in which the new growing polypeptide chain is synthesized.
Q: In eukaryotes, which of the following statements is correct with regard to introns and exons?…
A: Eukaryotic DNA carries the nonprotein coding sequences.
Q: Sometimes errors occur during transcription or translation. each amino acid is coded for by several…
A: This suggests that the genetic code is degenerate which means that each codon is specific for only…
Q: Which type of RNA carries activated amino acids to the ribosome for assembly into proteins? A.…
A: Ribonucleic acid is a polymeric molecule essential in various biological roles in coding, decoding,…
Q: True or False Process of translation 1. transfer RNA is made from messenger RNA 2. tRNA uses…
A: Translation: The process of translation involves the synthesis of a protein or a polypeptide inside…
Q: An intron is a section of ________. DNA that is removed during DNA processing protein…
A:
Q: Which rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes? A.…
A: ribosomal RNA one type of RNA molecule in cells that forms part of the protein-synthesizing…
Q: (a) Match the following list of RNAS (left side) with their function(s) (right side). w. MRNA X.…
A: The study of molecular biology has led to the discovery of various smaller molecules of RNA which…
Q: c. In transcription, the information in the DNA of every cell is converted into small, portable RNA…
A: The DNA is transcribed into mRNA by RNA polymerase and then this mRNA is translated into polypeptide…
Q: Match the following list of RNAs (left side) with their function(s) (right side). w. mRNA i. block…
A: The genetic material DNA is converted into RNA by the process of transcription therefore RNA is also…
Q: Q. Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub- parts for…
Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a…
A: The anticodon of the tRNA is 3'-UAC-5', and it binds to a codon in an mRNA with the sequence…
Q: Which modification of eukaryotic mRNA is likely absent if the mRNA can leave the nucleus but cannot…
A: mRNAs are formed in the form of primary transcripts.
Q: Which of the following sites would you predict to be present in the gene encoding a MRNA molecule…
A: mRNA known as messenger RNA carries the genetic information that is copied from DNA. mRNA contains…
Q: Ribosomal RNA is a component of ribosomes. What are ribosomes?
A: A molecule similar to DNA is ribonucleic acid (RNA). RNA is one-stranded, unlike DNA. The backbone…
Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…
A: In molecular biology, mRNA is a single-stranded molecule of RNA that corresponds to the genetic…
Q: Identify the correct recognition site for ribosomal subunit binding during translation. the 30s…
A: A process of protein synthesis is known as translation. The translation process contains three steps…
Q: Messenger RNA is single-stranded molecule while tRNA and rRNA molecules are double-stranded…
A: massanger RNA (mRNA) molecules convey the coding successions for protein union and are called…
Q: Which of the following is the correct sequence for RNA splicing: 1. U2 binds to the branch site and…
A: Interaction of the U1 snRNP to the 5′ splice site (5′ ss) and engagement of splicing factor 1 and U2…
Q: what is the first event to take place in translation in eukaryotic cell? a. An clongation of the…
A: Translation is the process which is responsible for synthesis of protein from the mRNA.
Q: Match the following list of RNAs (left side) with their function(s) (right side). mRNA…
A: The "double-helical structure" of DNA is duplicated through a process referred to as DNA…
Q: Gene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in…
A: Gene is present in the DNA. The gene is a sequence of nucleotides that encode a polypeptide. The…
Q: Based on the electron micrograph shown, which of the following statements is/are correct/true?…
A: Introduction :- Microorganisms, cells, big molecules, biopsy samples, metals, and crystals are among…
Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…
A: The mRNA is produced from DNA by the process of transcriptions. The initiation of DNA transcription…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: DNA consists of two intertwined polynucleotide strands: coding strand and template strand. The…
Q: How would the removal of the TATA box in a eukaryotic gene impact transcription? Group of answer…
A: A gene is the stretch of DNA that codes for a polypeptide.
Process of translation *( Choose True if the statement is correct abourt genetic code and False if otherwise )
- includes covalent modification of some proteins
- participation of rRNA
- transfer RNA is made from messenger RNA
- tRNA uses information from mRNA to produce amino acid chains
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Process of translation *( Choose True if the statement is correct about Process of translation and False if otherwise ) includes covalent modification of some proteins participation of rRNA transfer RNA is made from messenger RNA tRNA uses information from mRNA to produce amino acid chainsName (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
- Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAGAmino acid sequence: Look at the m-RNA message below: PUT A NUMBER under each of the t-RNA/amino acid complexes to show the correct sequence that they would attach as this message is read. phenylalanine leucine lysine methionine AUGUUC A A ACUG UUU UA MRNA WHAT IS THE AMINO ACID SEQUENCE FOR THE PROTEIN THAT WOULD BE PRODUCED FROM THIS MESSAGE? MATCH THE PARTS IN THE DIAGRAM WITH THE CORRECT LABEL. RIBOSOME в Asparagine D. NUCLEUS Methionine MESSENGER RNA ANTICODON E AMINO ACID CODON TRANSFER RNAAll of the following are true about translation EXCEPT _____. as the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide when the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA Ribosomal subunits and a tRNA-carrying methionine converge on the start codon of an mRNA
- Genetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tailAt least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. mRNA in eukaryotes, can exist outside the nucleus acts as an enzyme for peptide synthesis composed of ribonucleic acid rRNA Answer Bank moves amino acids to the site of protein synthesis tRNA contains nucleotide triplets that code for specific amino acids has a convoluted structure with a three-base sequence called an anticodon moves genetic information out of the nucleus and into the cytoplasm mRNA, rRNA, and tRNAUse a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||Codon chart: We interpret mRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter A G UUU UUC J UGU Cys UCU) UCC UCA UCGJ UAU U Phe Tyr UACS UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UUG FLeu G CUU ) CỤC CUA CUG CCU ) ССС ССА CCG CGU CGC Arg CAU) CÁC His САА Leu Pro CGA Gin CAG CGG AUU AAU ACU АСC ACA Asn AGU Ser AAC JAsh AGC. AUC le A AUA AGA Arg Thr AAA AAG. }Lys A AUG Met ACG AGG J G GUU GUC G Val GUA GUG GCU) GCC GCA GCG GAU1 GACS GAA) GAG Glu GGU GGC Gly U C A Ala GGA GGG] G First letter UUAG Third letter
