Practical_5 Marks.txt 1. Write a C++ program to read the contents of Marks.txt file and then find out the students with the minimum score and the maximum score (sample) Ahmed 90 and display their names and scores on the screen and a file called results.txt. Badria 85 Noor 91 Khalid 70 Said 65 Suha 80
Q: 1. Write a program in C++ to print your full name and the sum of two numbers and determine if the…
A: ALGORITHM:- 1. Take input for the name from user. 2. Take input for the numbers from the user. 3.…
Q: Write a program that mimics a calculator. The program should take as input two integers and the…
A: logic:- Define 5 functions i.e add, sub, mul, division, display. First four functions will take a…
Q: What is (are) the error(s) in the following programs. in C++ #include using namespace std; int…
A: I give the code in C++ along with output and code screenshot i also highlighted the changed part
Q: Palindrome is a word that reads the same backwards and forwards e.g. MADAM, POP, TAT etc. are…
A: Start Check till middle of string If character at present index is same as that from ending,…
Q: 1- Write a C++ program to ask the user to enter their first and last name and save them in a string.…
A: Q1: Code: #include <iostream> using namespace std; int main(){ string firstname,lastname;…
Q: what seems to be wrong with this C program. Please debug it for me. Copy-paste the new source code…
A: ANSWER:
Q: //What is your input? ___
A: What is your input?Ramesh Kumar
Q: Program in C. Create a program that asks the user for information about a country. It should ask…
A: Program: //include the header file #include <stdio.h> //definition of main function int…
Q: Question 2.2 Write a c++ program to generate 10, 2 digit random numbers and print all the numbers,…
A: here have to determine about c++ code for print 10 random number and max of them.
Q: 01: write a program in c++ Language to insert two integer numbers and then swap these numbers by…
A:
Q: Program 8: Write a C program that picks a random number from 1 to 100. Allow the user to guess the…
A: SOURCE CODE: #include <stdio.h>int mid_val(int a[]){int…
Q: 2. Write a program in C to count the total number of alphabets, digits and special characters in a…
A: #include<stdio.h> int main(){ char st[100]; printf("Input the string: "); gets(st);…
Q: HW2: Write a C Program that read a number from the keyboard and find wether the number is a or (9l…
A: Prime number : A number is said to be a prime number if only if the number has two divisors 1 and…
Q: Write a C program that calculates the employee salary and print the information as follows: - Your…
A: As per question the code is given below:
Q: what is the output of the following C++ code segment? int numbers [ 1 = {10, 20, 30, 40, 50}; cout «…
A: Todo : output of the given code:
Q: 6.26 LAB: Count characters - functions C++ Write a program whose input is a character and a…
A: Below is the required C++ program: Program Approach: Defining a necessary header file. Using…
Q: plz plz plz .... USING little Man PROGRAM !!!!!!! NOT A programing language (c# , c++ .....) I…
A: the answer is given below:-
Q: Q3/1/ Write a program in C++language, to read three numbers and then after the number with the…
A: PROGRAM INTRODUCTION: Include the required header files. Start the definition of the function in…
Q: Write a C Program A bank wants a program that determines the yearly interest earned on a guaranteed…
A: #include<stdio.h> int main(){ //declare the variables to store amount, interest, term…
Q: 40. Write a program in C++ that reads ten names then ask user to enter name then print the number of…
A: Coded in C++.
Q: (c) What are the values of the variables incr, de cr, and total after the following code fragment is…
A:
Q: Q1/ Write a program in C++ that reads 15 numbers and calculates and prints the sum of every three…
A: We will print sum of 3 consecutive numbers in an array and also average of them using if condition
Q: 1- The value of s could be calculated from the equation below: Jy? – 4xz if y2 4xz S= inf if y < 4xz…
A: Solution: Given,
Q: The problem statement is described in the problem_statement.pdf file. Write the solution into the…
A: Below i have answered:
Q: Q4:- write a program in c++ language to read the height of cylinder then calculate the volume and…
A: #include <iostream>using namespace std; int main(){ /* Taking input height and radius of…
Q: 3. 333221(from codeChum, modified) by Catherine Arellano Make a C program that will output the…
A: Here I have defined the function named getNum(). Inside the function, I have taken input from the…
Q: Create C a program that add books to the library system. Details on the books are as follows: --…
A: Include necessary header files Declare the variables Book_name, desc, auth, category, quantity, i,…
Q: What is the output of the following code in C? #include main() { int a=2; for( ;a;) printf(“…
A: In this code written in C language , we should have knowledge of for loop to understand this:- Lets…
Q: This is in c++ 1. Prompt the user to enter a string of their choosing and output the string. 2.…
A: Program to prompt the user to enter a string of their choice and display the string. The function…
Q: Q2: Write a C++ program with a class to enter student information including (ID, Name, Age,…
A: Create a class then, create instances using a for loop which can be used to iterate for 100 times…
Q: Write a C code that creates an honor list for the top six students at SMC. Your program does this…
A: Program Plan:- 1. Initialize all the required header files. 2. Declare the three main variables…
Q: Q4) Write a program in C++ language to obtain the equation below, for value of i (1 to N), by using…
A: // C++ program to perform operation on numbers from 1 to N #include…
Q: This is a C program. I want you to convert it to a C++ program. Also provide a screenshot that it is…
A: In this question, we are asked to change a C++ program into C. The new changes: 1) Changed header…
Q: Exercise 1: Write a C++ program that asks the user to enter the value for input variables, and…
A: // Code #include <iostream> using namespace std; int main(){ cout<<"Enter number1:…
Q: 1. Write a complete C++ program that lists all numbers that are perfect squares in a range. •…
A: Answer in step2
Q: 1. Write a complete C++ program that lists all numbers that are perfect squares in a range. •…
A: ALGORITHM:- 1. Generate the value of low between 50 & 200. 2. Generate the value of high between…
Q: 3. A certain CS professor gives 100-point exams that are graded on the scale 90-100:A, 80–89:B,…
A: Ans: Code: score = int(input("Enter the exam score:"))if score > 90 and score < 100:…
Q: Write a program that will ask the user to enter a number n and display the sum of all numbers from 1…
A: 1.Write a program that will ask the user to enter a number n and display the sum of all numbers from…
Q: Part 2. Create a C++ program that will input student’s ID, scholarship code (“A/a-D/d”), units and…
A: Given: Part 2. Create a C++ program that will input student’s ID, scholarship code (“A/a-D/d”),…
Q: ii) In C programming language, write a program to input a floating-point number and the number of…
A: The code is given below
Q: 3. 333221(from codeChum, modified) by Catherine Arellano Make a C program that will output the…
A: The program is written in C Language. Please find the source code and output in the below steps.
Q: 46- Identify the correct function from which the execution of C++ program starts? * • New() •…
A: 46. main() 54. Arithmetic 30. letter 44. for loop
Q: I need help in understanding this C++ Program. I would like to know the codes used, how it works, a…
A: #include<iostream> using namespace std; //std namesapce int main() //main program {…
Q: Q/ A College of engineering is advertised to call high school graduates to apply to its departments…
A: Problem Statement: A College of engineering is advertised to call high school graduates to apply to…
Q: 3- Write a program in C++, to read a number and calculate the average of the digits it consists of,…
A: The program is written in C++ Please find the program in the following step.
Q: Palindrome is a word that reads the same backwards and forwards e.g. MADAM, POP, TAT etc. are…
A: #include<iostream>#include <cstring>#include <algorithm>using namespace std; int…
Q: Write a complete C++ program to find the sum of prime numbers. You should prompt the values from the…
A: 1. If the number is less than 2 1. Return false 2. Else 1. Declare and initialize the flag…
Q: 2. You have to write a program to input two strings x2, x2 from the user and print the string x1x2…
A: Required:- 2. You have to write a program to input two strings X1, and X2 from the user and print…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Instruction: It should be a C++ PROGRAM INCLUDE THE HEADER FILE, MAIN CPP, AND BSTREE.CPP There is a real program developed by a computer company that reads a report ( running text ) and issues warnings on style and partially corrects bad style. You are to write a simplified version of this program with the following features: Statistics A statistical summary with the following information: Total number of words in the report Number of unique words Number of unique words of more than three letters Average word length Average sentence length An index (alphabetical listing) of all the unique words (see next page for a specific format) Style Warnings Issue a warning in the following cases: Word used too often: list each unique word of more than three letters if its usage is more than 5% of the total number of words of more than three letters Sentence length : write a warning message if the average sentence length is greater than 10 Word length : write a warning message if the…Computer Science C++ Create a text file "input.txt" with a certain amount of integers (you decide how many). Write a program that reads these numbers from the file, adds them, and when you have reached the end of the file, calculates the average of these numbers. Print a message and the average to the console. Code this program twice, demonstrating the two methods to detect the end of the file, part A: reading a value from Instream and storing it (boolean expression) in the while loop part B: using the eof() member functionCode should be in Python. A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names. Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. (Examples in image)
- Hi there, could you help me with this c++ hw ? with explanation please! 2. Develop a program that asks for the user's name, phone number, and address. The program then saves all information in a data file (each information in one line) named list.txt. Finally, the program reads the information from the file and displays it on the screen in the following format:Name: User's Name Phone Number: User's Phone Number Address: User's Street Address User's City, State, and Zip Codecreate a file in c++. Download the attached CreateRandomNumbersFile.cpp file, open it in Dev C++, and then compile and run it. The program should generate a file called "numbers_lastname.txt" in the same folder as the program (replace lastname with your last name). Write a program that asks for the name of an input file. Then, read all the numbers in the file, and display the following information to the screen: name of the input file count of numbers in the file sum of all numbers in the file average of all numbers in the file (to 2 decimal places) count of numbers in each range (100-199, 200-299, 300-399, etc.) The program should: display a hello message ask the user for an input file display the name of the input file display statistical information as shown above display a goodbye message create random numbers: /* This program will ask the user for their last name, which will be used for* naming an output file. The output file will consist of 500-999 random* integers, all…C++ Create a program to open a text file and read in multiple lines of data. Use a regular expression to see if each line contains: Your First Name, Your Last Name, Your First Name or Last Name (anywhere in the text) Your First Name and Last Name (anywhere in the text) Your First Name followed by your Last Name (can contain text between first and last - such as middle name or middle initial).
- The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonThe file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAAThe file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcomposition
- A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names. Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. Ex: If the input of the program is: ParkPhotos.txt and the contents of ParkPhotos.txt are: Acadia2003_photo.jpg AmericanSamoa1989_photo.jpg BlackCanyonoftheGunnison1983_photo.jpg CarlsbadCaverns2010_photo.jpg CraterLake1996_photo.jpg GrandCanyon1996_photo.jpg IndianaDunes1987_photo.jpg LakeClark2009_photo.jpg Redwood1980_photo.jpg…A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names. Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. Ex: If the input of the program is: ParkPhotos.txtand the contents of ParkPhotos.txt are:…Can i get help writing this program in c++ on microsoft visual 19 with this input file incorporated. The client should read in the file contents and store them in the object. The file will be formatted such that the first line contains the month name, the second line contains the year, and each successive line contains a temperature. A typical input file might contain: June 2019 90 85 97 91 87 86 88 82 83 85