n your experiment there will be 4 different experimental samples labeled A-D (please see Table 3 on page 12 of the Lab 4 handout). In sample D, if you saw some bacterial colonies that are blue and some colonies that are white, what would this tell you? Group of answer choices the sgRNA was completely non functional the CRISPR/Cas9 donor DNA repair is not 100% efficient there is no functional lacZ on this bacterial plate arabinose was not active on this bacterial plate
Q: What are the results from the gram stain and result of the API strip ? (Positive/ negative) for each…
A: The bioMerieux catalog/APIweb is a software product that contains all of the API databases for a…
Q: You work in an environmental microbiology research lab, and your project is to design a recombinant…
A: Our task as research assistants in an environmental microbiology lab is to create a recombinant…
Q: Glyceraldehyde-3-phosphate (G3P) can be used by plant cells to make and 2. Which molecule in Diagram…
A: Diagram shows, Glyceraldehyde 3 Phophate has been converted into starch and sugar molecules. All the…
Q: Order: dopamine (Intropin) 10 mcg/kg/min IV Patient 150 lb Supply 400mg/250 mL D5 Round to a whole…
A: Hi, thank you for your question, but clearly state in the question what is being calculated in the…
Q: What is the evidence that coevolution of different resource uses allows different finch species to…
A: Co evolution is a phenomena in which an ancestral species may develop simultaneously into different…
Q: Select all the characteristics from the answer bank that describe three environmental extremes that…
A: Archaea is an evolutionary phylogenetic domain that shares common features with Eukarya domain.…
Q: What would be the result of gram stain of Neisseria sica ? How can we write a conclusion about API…
A: Neisseria sicca is a species of bacteria, and the Gram stain is a crucial microbiological technique…
Q: Climate change and global warming patterns have caused ocean temperatures to increase over the last…
A: In the context of climate alter and rising worldwide temperatures, the researchers' algae cultivate…
Q: Discuss the pathway of air through the respiratory system of vertebrate
A: The respiratory system in vertebrates, including humans, facilitates the exchange of gases,…
Q: During which phase of the cardiac cycle is the ST segment present on an EKG? Group of answer choices…
A: This question is about how the heart works and how it appears up on a heart monitoring test called…
Q: Different species of protist populations were measured in terms of the total volume of cells in a…
A: The competitive exclusion principle states that two species cannot co-exist in the same habitat…
Q: How does the cell’s volume influence the amount of material that must be exchanged across the cell…
A: Imagine a cell as a tiny living room. If the room (cell) becomes too big, it needs more food and…
Q: ain A: wild type........ .CT value of 15 ain B: has mutation X in the promoter region........CT…
A: Quantitative reverse transcription polymerase chain reaction, also called RT-qPCR, is a molecular…
Q: As used in the interaction grid, MUTUALISMS are: Plus/plus interactions between two different…
A: An ecosystem deals with both biotic and abiotic factors and their interaction with each other as…
Q: Discuss The force-pump method in amphibians.
A: All creatures need to breathe in order to exchange gasses, especially carbon dioxide and oxygen. The…
Q: QUESTION 17 In the regulation of blood pressure, juxtaglomerular cells respond most to changes in…
A: This request concerns blood pressure control and the part that juxtaglomerular cells play in this…
Q: How does a cells volume influence the amount of material that must be exchanged across the cell…
A: The question is asking about the relationship between a cell's volume and the amount of material…
Q: How is the oxidase test performed? Using Kovac’s reagent swab
A: The oxidase test is a microbiological test used to identify bacteria that produce the enzyme…
Q: if normal GFR is 125ml/minute, how long does it take to produce 1 liter of urine assuming 99% renal…
A: Reabsorption is defined as the return of most of the filtered water and many solutes to the…
Q: what is the benefit of the telapia fish to human then need to put the author. Need like wall…
A: Consuming a range of foods, including different sorts of fish, natural products, vegetables, and…
Q: Compare the 95% confidence interval for the difference between two true means with the 95%…
A: Confidence intervals are essential tools in statistics for estimating the range within which a true…
Q: What is wrong with the following statements: (a) "OK, we'll do an audit program, but we can't…
A: There are different statements regarding to various conditions and there are some flaws in each…
Q: Male bullfrogs fighting for access to females for mating purposes is an example of: O Exploitation…
A: Competition is a type of negative interaction which occurs, when two organisms compete for the same…
Q: QUESTION 2: What are the names of the steps of the PCR reaction that are repeated multiple times…
A: Polymerase Chain Reaction, or PCR, is a molecular biology technique employed to amplify and…
Q: Language functions are scattered widely in the left hemisphere. There is also evidence that the…
A: The question is asking to identify the term that refers to the use of intonation, emphasis, and…
Q: Which statement about interaction networks is true? They show that most interactions are highly…
A: Interaction networks in ecology refer to the complex web of interactions between different species…
Q: 1a) You are studying two populations of pika. You find that the population inhabit in talus (broken…
A: Determining whether the two pika populations belong to the same species or are two different species…
Q: Chimeric antigen receptor T cells (CAR-T cells) are generated as an in vivo gene therapy. A-True…
A: Chimeric Antigen Receptor T-cell therapy is an innovative immunotherapy that has shown promising…
Q: a. Summarize in the Table below the predicted fragment lengths for the TAS2R38 Genotype. b. Genotype…
A: The task at hand involves the analysis of gel electrophoresis results to determine the TAS2R38…
Q: 2. The promoter (P) is the start site of transcription through the binding of RNA polymerase before…
A: The lac operon: The lac operon or the lactose operon is the most widely studied gene with respect to…
Q: The human body plan would be most accurately described as having: asymmetry radial symmetry…
A: Symmetry is defined as when an object or shape can be divided into two or more equal halves by a…
Q: Match the tissue shown with its function. option: 1. Present in bone marrow, spleen, and lymph…
A: Tissues are groups of cells that work together to perform a specific function. In the human body,…
Q: For a lab on diffusion and osmosis, where a egg yolk was placed in a cup water the following…
A: The movement of water inside an egg yolk is influenced by the principles of osmosis. Osmosis is the…
Q: Describe how the proton (H+) gradient is used to make ATP what is the overall purpose of…
A: ATP or the Adenosine Triphosphate molecule is the chemical energy molecule produced after the…
Q: How does carbon monoxide affect white blood cells and plasma?
A: In the realm of environmental and occupational health, the effects of carbon monoxide (CO) on the…
Q: Constricting the efferent arteriole will decrease, increase increase, increase decrease, decrease O…
A: The kidneys play a crucial role in maintaining the body's acid-base balance, ensuring optimal…
Q: II. Making your Master Mix and PCR Set up for TPCN2: Note: the reaction volumes will be 20 µL and n…
A: The task at hand involves preparing a Master Mix for a PCR setup for the TPCN2 gene. This includes…
Q: ANSWER THE FOLLOWING QUESTION
A: The question is asking about the agents that are responsible for transmitting diseases from one host…
Q: Carrier proteins that bind to substances to move them through the membrane and proteins that form…
A: Proteins are one of the integral groups of biomolecules. They have diverse functions such as…
Q: Match the tissue shown with its function. option: 1. Present in bone marrow, spleen, and lymph…
A: Tissues are historically derived biological term organizing level in biology that lies between…
Q: Cystic fibrosis is a homozygous recessive condition that affects 1 in 10,000 of the Hispanic…
A: The illness known as cystic fibrosis harms your digestive system, lungs, and other organs. It is a…
Q: Discuss the Direct and indirect respiration
A: Respiration is the process of gaseous exchange that is intake of oxygen from the atmosphere and…
Q: Membrane Receptors and Medicine. A patient, who has a stressful job, comes in with high blood…
A: The use of beta-blockers in the management of hypertension represents a pharmacological approach to…
Q: Based on the maps above, in which areas would you find the greatest marine biodiversity? A…
A: The inquiry centers on identifying regions exhibiting the highest marine biodiversity by…
Q: Why is it difficult to study whether a trait is due to epigenetic changes or due to something else?…
A: The objective of the question is to understand the challenges in studying the role of epigenetic…
Q: According to the Frank-Starling law of the heart, an increase in right atrial pressure and…
A: Cardiac output alludes to the volume of blood that the heart pumps per unit of time, typically…
Q: Did not fully answer the question. Please answer the question.
A: Bacterial cultures play a crucial role in biodegradation processes, utilizing specific substrates…
Q: Can genetic ancestry tests be used to determine specific ethnic or cultural affiliations within a…
A: The objective of the question is to understand the capability of genetic ancestry tests in…
Q: ductor Pollicis Brevis m
A: The primary forearm flexor muscles include:1. Flexor Digitorum Superficialis: Located on the…
Q: Which of the following animals uses a tracheal system to breathe? -Insects -Crayfish -Brittle…
A: Breathing can be described as a taking in air rich in oxygen and giving out air rich in carbon…
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 oriIn your experiment there will be 4 different experimental samples labeled A-D (please see Table 3 on page 12 of the Lab 4 handout). If you saw no bacterial colonies growing in sample A (pLZDonor, no arabinose), what would this tell you? Group of answer choices the bacteria has been successfully edited to include the donor template DNA the sgRNA caused a double-strand DNA break which caused the bacteria to die the DNA transformation was not successful there is functional lacZ in this sampleAnalyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
- Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'5' UTR 5' and 3' UTR This region is specific sequence surrounding the start codon. OK Os OT OP LEU2 KSTP 2μm plasmid DNA Gene of interest 2μm plasmid DNA GAPDI GAPDP SC Cu/Zn-SOD cDNA Amp oriE gene What is selectable gene in this vector? 3' UTRTable 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name Recognition sequence and position of cut 5'GIAATTC3 5'G!GATCC3' 5'GIGTACC3 5'GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3 EcoRI ВатHI Аcс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.
- Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleShown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to 330. Transcription starts at the Transcription Start Site (TSS) that is the base located at position 57. -55 5' AATAAСTTGAGATTTTGATTGACАТССТТСТСАCAGAGCCTATAATACCТАТТТС 3' 3'TТАТTGAACTСТААААСТААСТGTAGCAACAGTGTCТСGGATATTATGGATAAAG 5' 56- 5' ТACGTATAGAСАСТСAGAGGAAAGACAGAGAGAGAGTTAGCATTGTACTАТСТСТ 3' 3' АTGCATATСТсTGAGTCTCCTTтстстстстстсТСААТСGTAACATGATAGAGA 5' 65- -105 --110 -140- 5' СТTTTAGATATATCTCТАТСТСТСТСАСТССАТСТТТСТCGTGTTAACACAAСА 3' 3' GAAAATCTATАTAGAGATAGAGAGAAGTGAGGTAGAAAGAGCACAAТТСTСТTGT 5' 111- -120- -130- -150- -160----165 166- --175- --185- -195 -205- -215-----220 ------- 5' GTCACAGACTCACAGATCTTTGTCGGTGATCGGAGATGGAGTTCCGGGAGAAGCT 3' 3' CAGTGTCTGAGTGTCТAGAAACAGCCACTАGССТСТАССТСААGGCCCTСТТCGA 5' 221- -230- 240 -250 -260 -270-----275 5' TTATAAGTTCAAGTTGCAATAGGTGTTTGCCTTTGTTTTATCTCTCCTCACCGTA 3' 3'ААТАТТСААGTTCAACGTTATCCАCAAACGGAAACAAAАТAGAGAGGAGTGGCAT 5' 276- -285- -295- -305 -315…
- Sal1 Xho1 Insert pUC cloning vector MCS Insert Digested with Sal1 on the left and Xho1 on the right Sal1 Ori Vector Digested with Sal1 Xho1: СТСGAG Sal1: GTCGAC RE cut site Part B) After 8 h of sleep, you realize your mistake above (Question 3 Part A), and you successfully transformed your plasmid and obtained a subset of white colonies and blue colonies on the plate. Question: You conclude that all the blue colonies contain a plasmid O With the insert in the LacZ screening marker With the insert in the Antibiotic selectable marker O Without an insert in the LacZ screening marker O None of the above + Lacz alpha AmpR1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: