If you were to send in your DNA to a genetic ancestry company, who is your DNA compared to? A. Everyone in the world B. Everyone in their specific database C. Everyone who lives in a major city around the world D. Everyone in the U.S
Q: Order the events relative to one another based on when each occurred in the fossil record. Earlier…
A: Fossils are the preserved remains of ancient organisms ( including animals, plants and…
Q: For the following sets of partial diploid bacteria, is the Z gene constitutive, inducible, or…
A: An inducible gene is a gene that can be turned on or off in response to specific signals or…
Q: Observe the results from a disc-diffusion experiment below. Which antibiotic would you prescribe to…
A: The objective of the question is to determine the most effective antibiotic for a patient with a…
Q: RBC's can oxidize acetyl CoA into CO2 and Water. O True O False
A: Red blood cells are specialised cells that contains hemoglobin an iron containing protein. It is…
Q: a. Phylogenetic relationships based on chloroplast genes Brown algae Diatoms Most photosynthetic…
A: Chloroplast is an organelle which is responsible for photosynthesis. It was acquired by a bigger…
Q: a. Individuals who have severe allergies (for example, to bee stings or peanut butter) often carry…
A: The body loses 21% of the epinephrine
Q: A patient presents to an emergency room with severe internal bleeding and needs an immediate blood…
A: A patient with severe internal bleeding presents to the emergency room. The facility has none of the…
Q: Risk management identifies that a newly hired nurse has been diverting narcotics intended for…
A: Drug diversion refers to the illegal or unethical practice of diverting prescription medications,…
Q: ansport in mitochondria all olysis ase in the brain
A: All the statements talk about different kinds of inhibitors. Inhibitors are the substances in the…
Q: Which of the statements regarding plasmodesmata is true? They are channels, located in the plasma…
A: Plasmodesmata are microscopic openings found in plants cells. They help in connecting two adjacent…
Q: Define the three classes of motor units and their role in muscle innervation
A: A motor unit is the basic functional unit of the muscular system. It consists of a motor neuron and…
Q: What is the function of these bone in frog? (1-2 sentence only) Calcaneum Astragalus Tarsals…
A: The function of each bone in a frog:1. Calcaneum: The calcaneum in a frog's feet helps in extending…
Q: Which is the amino acid represented below? I H₂N O OH
A: The building components of protein are amino acids. Long strands of amino acids make up proteins.…
Q: When a woman is twenty weeks pregnant, the organs of what system are getting pushed upward in the…
A: Around the 20-week mark of pregnancy, which is considered the midpoint of a full-term pregnancy,…
Q: Match the tissue shown with its function. option: 1. Present in bone marrow, spleen, and lymph…
A: Immune system consists of defense system in a host consisting of a widely distributed cells, tissues…
Q: With a genotype of the parents of YYRR x YyRr, what is the percent probability of offspring having a…
A: The term "genotype" describes an organism's or individual's genetic composition. It denotes the…
Q: Discuss the Respiratory muscles
A: Respiratory muscles are responsible for the mechanical aspects of breathing, facilitating the…
Q: Distinguish molecules that can diffuse through a lipid bilayer from those that must be transported.…
A: Active transport is a process that requires energy to move molecules against their concentration…
Q: Not all bones are suitable for bioarchaeological analyses, rendering age and sex estimations…
A: The objective of the question is to understand the factors that might influence the suitability of…
Q: NCI 1000 800 600 400 200 8 00 O 0,00 O 9.0 0,20 O 8 00 0,40 Stress O 0,60 p=0.053 R=0.2981 0,80…
A: Stress is a physiological and psychological condition of the body due to various environmental…
Q: A researcher is interested in the geographic ranges of two types of mountain ground squirrels that…
A: A biological interaction in ecology refers to the impact that coexisting species have on one…
Q: Which of the following statements is true? A. B. C. D. The Peptide bonds are the only covalent bonds…
A: A. "Peptide bonds are the sole covalent links capable of connecting two amino acids within…
Q: 11 10 8 123 6 5 6. Describe the pathway (ducts) that a sperm cell would travel from its production…
A: The human reproductive system is a complex system of organs that work together to produce offspring.…
Q: What is the evidence that coevolution of different resource uses allows different finch species to…
A: Co evolution is a phenomena in which an ancestral species may develop simultaneously into different…
Q: Sergio's partner is HIV+, but Sergio is HIV negative. Sexual intercourse is considered "high risk"…
A: The objective of the question is to understand the measures that Sergio can take to reduce the risk…
Q: 5' GTATGTTACGTAACCTCTGCCTGCTAAGGGTAGAATATAGCTACGCTATCGATGGTAGCTAGCGATCG 3' a b с 29) Examine the…
A: This question asks to identify the binding site for the transcription factor TFIID in a given DNA…
Q: 1. The B-galactosidase gene of the lac operon is expressed at high level when which combination of…
A: High lactose concentration induces the production of the B-galactosidase enzyme. Lactose acts as an…
Q: Competition for limited parking spaces in a UA parking garage is (usually!): Interspecific…
A: In community eclogogy, competition is the type of biological interaction between organisms or…
Q: Based on the pET-28a map and based on the nucleotide sequence of the OXA-M290 gene, could the…
A: To determine whether the restriction enzymes Sac I and Hind III can be used for cloning the OXA-M290…
Q: In your own words, explain what happened in the following scientific experiment: Male mice were…
A: The question is asking about the results of a scientific experiment where male mice were conditioned…
Q: Compare a Male Baboon to a Male Human. Compare the Articulated Foot, the Coccyx/Sacrum/Os Coxae, and…
A: The objective of this question is to compare the anatomical structures of a male baboon and a male…
Q: Experiment to test how one of the following variables impacts the growth of Brassica rapa: Water,…
A: These four variables are thought to control the growth of Brassica rapa - water, nutrient…
Q: You are evaluating a patient with intermittent clauditions in his right calf due to peripheral…
A: In the given scenario, an atheroma has halved the diameter of a patient’s popliteal artery from 10mm…
Q: Which statement about the relationship between specialization and obligacy are true? Some but not…
A: Specialization in ecology refers to the adaptation of a species to perform specific functions or…
Q: Discuss the parts of the tooth
A: The tooth is a rigid calcified structure found in most vertebrates, serving the purpose of tearing,…
Q: Hello, I want you pleaseeee to make a dichotomous key based on provided experiments to identify a an…
A: The method of identifying an unknown bacterium is a precise one, requiring cautious perception and…
Q: Could we potentially make cells immortal, thus making humans immortal? The Turritopsis dohrnii, is a…
A: The concept of cell immortality refers to the ability of cells to avoid the typical processes of…
Q: Which of the following structures of the heart is responsible for pumping the blood to the lungs?…
A: Heart is the main pumping organ of the body. It is divided into four chambers - two upper atrium and…
Q: write a summary :Currently used animal and cellular models for pulmonary arterial hypertension (PAH)…
A: The passage is about pathophysiology and course of development of pulmonary arterial hypertension (…
Q: QUESTION 14 Increasing the secretion of ADH O increases, decreases O increases, increases decreases,…
A: The crucial hormone known as ADH is in charge of maintaining blood pressure, osmolar balance, and…
Q: https://lupusla.org/ana-test-for-lupus-diagnosis-what-you-need-to-know/ Ella Baker is the name of…
A: An annotated bibliography is a compilation of sources with a brief summary and analysis of each…
Q: Two individuals from the San tribe in Africa are more diverse from one another than two individuals…
A: The objective of the question is to verify the truthfulness of the statement that two individuals…
Q: Refer to image and answer each!
A: The first part of the question asks for the three stages of labor and a brief description of each.…
Q: Discuss the types of dentition as to: Attachment Replacement Size and shape of crown
A: Dentition refers to the arrangement, development, and characteristics of teeth.Different species…
Q: Why does linkage disequilibrium represent an advantage and a disadvantage for mapping genetic…
A: In the field of genetics, the phenomenon of linkage disequilibrium (LD) plays a pivotal role in…
Q: Where does mRNA/tRNA codon-anticodon recognition take place? a)40S b)50S c)The surface between…
A: The question is asking about the location within a cell where the recognition between mRNA codons…
Q: For the following sets of partial diploid bacteria, how do I fill out this table? I am not sure how…
A: The method of identifying bacteria frequently includes observing their behavior beneath diverse…
Q: What are the different types of vertebra based on the shape of centrum?
A: Vertebrae are the individual bones that make up the vertebral column, also known as the spine or…
Q: A pharmacy's stock includes lisinopril 20 mg tablets from one manufacturer with the NDC…
A: NDC, or National Drug Code, numbers are unique identifiers for medications, including prescription…
Q: Match the tissue shown with its function. option: 1. Present in bone marrow, spleen, and lymph…
A: There is one layer of variously sized cells, some of which are not accessible to the free surface;…
If you were to send in your DNA to a genetic ancestry company, who is your DNA compared to?
A. |
Everyone in the world |
|
B. |
Everyone in their specific database |
|
C. |
Everyone who lives in a major city around the world |
|
D. |
Everyone in the U.S |
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- (short answer) Imagine you’ve been offered a deal from a genomics company. You can get a free genome sequence – an analysis of all of your DNA that includes a report of your ancestry, traits and a medical profile. The medical profile tells you about diseases for which you have a low risk of getting, and also those you have a high risk of getting. Are you interested? Why or why not?Just like actual fingerprints, DNA fingerprints are unique to most individuals (other than identical twins). Today, most police departments in the United States use DNA fingerprints as a criminal investigation tool. What is another application of DNA fingerprints? O A. Identifyipg a person's personality traits O B. Identifying the father of a child O C. Identifying the sex of a future, not conceived offspring O D. Determining if a person has consumes genetically engineered plantsIf you are doing a research on making a family tree of your relatives from mother side which DNA test can help the most accurate and why?
- Which process consists of modifying an individual’s genome? a. DNA profiling b. SNPing c. genetic engineering d. DNA hybridization e. PCRGenetics is a rapidly evolving area of science. Each year advances in genetics bring exciting new technologies to the market. Areas such as forensics, genealogy, and healthcare have all been affected by new genetic technologies. Choose a genetic technology and report on how this technology is affecting or will effect our lives. Give at least one outside source and cite in APA format.A scientist wants to study the cytochrome c gene of a fruit fly. The DNA for the gene is extracted and subjected to several treatments. If a disease were identified as being caused by defects in the cytochrome c gene, then the copy isolated could be used for what? A. PCR B. gene therapy C. stem cell work D. DNA fingerprinting
- A science student is watching a television debate on the genetic cloning of animals. In order for the student to make a reasoned decision, the student must first? A. Justify the opinions presented in the televised debate B. Accept the views of the most qualified expert C.. Engage in a debate with others D. Consider all the points of viewMatching DNA samples in forensics uses a specific set of small “genes” called________ . The alleles of these genes in different people vary in the__________ of the allele. The pattern of these alleles that a given person possesses is called his or___________ her .Choose the basic chemical materials that are required to perform PCR. A. Two oligonucleotide primers. B. DNA fragment to be amplified. C. A heat-resistant DNA polymerase. D. All of the above
- Can a DNA test tell you where someone is from and "who" (which ethnic group) they are from? Why or why not?Using the data comparing the DNA sample from the wealthy man to the possible relatives, which individual is most likely related to the wealthy man?The goal of many captive breeding programs like zoos is to maintain 90% genetic diversity over 100 years. What do you think about this? Would you come up with something better? (1-2 paragraphs)