describe SARS-CoV2 Spike Protein
Q: 1 TC: 200 250 300 350 Wavelength (nm) UV/Vis spectrum of four brands of polysorbate 80, a common det...
A: Coomassie dye (Blue G-250; also refer as CBB) binds to protein and gives a colorimetric change in th...
Q: Which of the following would not be considered a reason for the decline in fat oxidation with increa...
A: Beta oxidation is a catabolic process that occurs in both prokaryotes and eukaryotes to break fatty ...
Q: Question 11: The ESI MS spectrum of a protein biomarker of a disease shows 3 consecutive peaks at m/...
A: Mass spectrometer has three important parts, an ionization source (to create atomic and molecular io...
Q: How does the body use amino acids? What is deamination? Define nitrogen balance. What conditions are...
A: The term "biomolecule" refers to a molecule created by living organisms or cells. The most common bi...
Q: As you learned in class, many enzymes can catalyze the forward and reverse directions of a chemical ...
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy...
Q: a) Assuming that ubiquinone is unavailable inside of the cell, calculate the AG and the Keq if elect...
A: Gibbs free energy: Gibbs's free energy is a calculation of chemical energy. All chemical systems fa...
Q: Below is the titration of histidine. Calculate the average charge of histidine at pH 6.50. ÇOON Hist...
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first q...
Q: gal(a1–6)gal(a1→6)glc(a1→2B)fru. Which of the complete IUPAC of this tetrasaccharide? O a-D-galactop...
A: The term "biomolecule" refers to a molecule created by living organisms or cells. The most common bi...
Q: Seatwork CH2 CH Identify the type of bond(s) that stabilizes the protein structures. H,C H,C CH CH H...
A: A peptide bond is a chemical bond between two amino acid residues in which the carboxyl group of one...
Q: How can you measure the element carbon (C) content using XRF?
A: XRF is a non-destructive analytical technique used to determine the elemental composition of materia...
Q: Of a 10%6 SDS solution in H20. The combined final solution would be 0.5M NaC1 and 1% SDS. If you are...
A: Molality is never equal to molarity. But the difference becomes lesser as the solutions become more ...
Q: cell wants to synthesize the a(1→4) dimer from two glucose molecules. Show the mechanism.
A:
Q: METABOLIC PATHWAYS. Carefully analyze the diagram below. Complete the diagram below by providing the...
A: Since we only answer up to 5 sub-parts, we'll answer the first 5. Please resubmit the question and s...
Q: fof NH HO-P-O-P-O-F `NH2 ÓH ÓH OH OH OH Which nucleotide is shown in the picture above?
A: A nucleotide is an organic molecule containing a nucleoside and a phosphate. It is the basic buildin...
Q: How do microorganisms affect people directly and indirectly? List and describe: 1) products produce...
A: Organisms that are of microscopic size are called microorganisms. They are also called microbes and ...
Q: 4. Identify the membrane lipids and describe their structures and roles. 5. Which is more hydrophili...
A: Since we only answer up to 3 sub-parts, we'll answer the first 3. Please resubmit the question and s...
Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to glute...
A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to dig...
Q: 1. In a serial dilution, one initially sets a starting dilution and adds an aliquot portion of it su...
A: Serial Dilution is a important procedure to obtain the desired concentration of reagent or serum or ...
Q: ATP Accounting Upon digestion of starch, isomaltose (an isomer of maltose), one of its degradation p...
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer upto three ...
Q: 4. A new drug is developed which selectively cleaves covalent bonds between two sulfur atoms of non-...
A: The disulfide linkages between the side chain -SH of cysteine residues that are distant in the prima...
Q: What are the disadvantages of using genetic engineering to obtain resistant plants?
A: The new genetic material (DNA and genes) has been transfecting or reprogramming cultured ce...
Q: In general, what is the purpose of washing the red blood cell prior to testing? What are some of the...
A: Red blood cells: The average human adult has more than 5 liters of blood in his body. The blood car...
Q: explain the biochemical processes involved in each of the following, in named cells. Start by mentio...
A: 1. Homolactic fermentation-(production of lactic acid) Purpose- Any form of fermentation that produc...
Q: The following were obtained in a study of an enzyme known to follow Michaelis-Menten kinetics: R...
A: Enzymes are proteins which accelerate the rate of biochemical reactions. The Michaelis-Menten plot r...
Q: . What are the tissue sources of Alkaline phosphatase? 2. What are Regan and Nagao isoenzymes? 3....
A: Alkaline phosphatase ALP is a ubiquitous membrane bound glycoprotein present in many mammalian tissu...
Q: Think about your favorite kind of pizza. How is your body provided with each of the four major biolo...
A: Food is made up of a wide range of nutrients including carbohydrates, fats, proteins, vitamins, mine...
Q: Ribosomes are made up how much RNA component? 1/3 2/3 50% 2/4
A: Ribosomes are the translation machinery of the cell. The ribosomes are ribonucleoprotein assemblies ...
Q: Use the following to answer the questions below: In each of the following multiple-choice questions,...
A: Lipids are insoluble molecules made up of carbon, hydrogen, and oxygen just as carbohydrates but in ...
Q: At a pH of 7.40, the carbonic acid ratio is, a. 35:1 b. 4:1 C. 20:1 d. 3:1
A: Given Values: pH = 7.4 pKa = 6.1
Q: In elongation, the creation of peptide bonds between amino acids is catalyzed by a. rRNA. b. a prote...
A: The letters of the nucleic acids are translated into amino acids, i.e., from nucleotide language to ...
Q: An ion-exchange chromatographic separation is performed using a diethyl-aminoethyl- (DEAE)-sepharose...
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These twen...
Q: Select the correct mechanism of each enzyme or drug enlisted below: * Inhibition via Enzyme Activity...
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...
Q: Emtricitabine (2,3-dideoxy-5-fluoro-3'-thiacytidine, abbreviated as FTC) is a nucleoside analog that...
A: Given Values: [FTC] = 10 nM [HIV RT] = 37.5 nM [HIV RT-FTC] = 2.5 μM=2.5×103 nM
Q: Name the experiment shown above and briefly describe how it is set up as well as the role of each co...
A: Gel electrophoresis is a method of separation of protein (SDS-PAGE, polyacrylamide gel electrophores...
Q: Which of the following types of bonds are responsible for the secondary structures of proteins? Cova...
A: Almost every function in living organisms depends on proteins. These are the biomolecules composed o...
Q: A membrane can separate gas mixture because different gases have different permeability through the ...
A: Gas separation by membrane is appealing in low-carbon technologies because it can be run in a contin...
Q: e tra led by the solvent Distance travellad bu
A: Chromatography is a technique by which we separate molecules from a mixture. In this technique, we u...
Q: Between direct and indirect allosteric kinase inhibitors, which do you think requires a larger confo...
A: In Allosteric modulation of enzyme/protein function, a modulator molecule binds at a site other than...
Q: In the cell membrane what are glycoproteins and what are their functions?
A: Cell membranes or plasma membranes are the biological membranes separating the cell interior from th...
Q: Draw the C-2 epimer of Ribose
A: Epimers are a pair of diastereomers, at one stereogenic carbon center of two epimers have at least...
Q: Viscosity and density fatty acid solution at room temparature
A: Viscosity, density : both decrease with the temperature increase because a larger temperature means ...
Q: In a spectrophotometer, what should be the appearance on the graph if the sample is pure? presence o...
A: Spectrophometry is a widely used technique in identification and confirmation of chemical substances...
Q: sugar
A: polysaccharides : it is a polymer made up of many sugar subunits, called monosaccharides . Polysacch...
Q: Give the functions of the following ingredients, then name a branded/commercial skin or hair care pr...
A: Ozokerite wax is dark brown or light yellow color mineral wax. It is made up of carbon and h...
Q: The biochemical function for the cholesterol present in cell membranes is a. Cell recognition b. Reg...
A: First 3 subparts have been answered ,as per guidelines. Please repost the last as separate question....
Q: What is the differences between competitive, noncompetitive, mixed noncompetitive and uncompetitive ...
A: Enzyme inhibition is of two types reversible and irreversible. During irreversible inhibition the in...
Q: With regard to item packaging, which is true: Group of answer choices Package each item separately; ...
A: True statement with regard to item packaging.
Q: HO, но. но NO2 G .F O,N" NO2 Br F 1. Provide the mechanism for the chemical reaction of pigment F wi...
A: The pigment in the question are Azo pigment/dye and is organic compound contains Azo group (-N=N-). ...
Q: Please define GMO in fish. Thank you
A: Transgenic animals: A transgenic animal is one that carries a foreign gene that has been purposely ...
Q: how does the sphingosine affect the physical properties of sphingomyelin?
A: Sphingosine: it is an important part of sphingolipids with unsaturated hydrocarbon chain. It belongs...
describe SARS-CoV2 Spike Protein
The world is battling with Coronavirus disease (Covid-19) which is caused by the SARS-CoV 2 virus. It affects different people in different ways and the symptoms range from fever, cough, loss of taste and smell to difficulty breathing and chest pain. SARS CoV 2belongs to the family of Severe Acute Respiratory Syndrome or SARS which is a viral respiratory disease and is caused by the SARS-associated coronaviruses. First identified in February 2003 and the second outbreak was reported in Dec 2019 that we are still struggling with.
Step by step
Solved in 3 steps
- Please help explain Angiotensin-converting enzyme 2 (ACE2) is a receptor for cell entry of SARS-CoV-2, and recombinant soluble ACE2 protein inhibits SARS-CoV-2 infection as a decoy. ACE2 is a carboxypeptidase that degrades angiotensin II, thereby improving the pathologies of cardi- ovascular disease or acute lung injury. Here we show that B38-CAP, an ACE2-like enzyme, is protective against SARS-CoV-2-induced lung injury. Endogenous ACE2 expression is downregulated in the lungs of SARS-CoV-2-infected hamsters, leading to elevation of angiotensin II levels. Recombinant Spike also downregulates ACE2 expression and worsens the symptoms of acid-induced lung injury. B38-CAP does not neutralize cell entry of SARS- CoV-2. However, B38-CAP treatment improves the pathologies of Spike-augmented acid- induced lung injury. In SARS-CoV-2-infected hamsters or human ACE2 transgenic mice, B38-CAP signi!cantly improves lung edema and pathologies of lung injury. These results provide the !rst in vivo…Name conditions caused by abnormalities of vertical linkages and horizontal (lateral) linkages in RBC transmembrane and cytoskeletal proteins.Calculate the specificity factor (a) of the interaction between the ACE2 protein and SARS-CoV-2 variant spike proteins at [ACE2] = 1 nM and 10nM. Show work pls
- Even single point mutations can have a significant effect on protein function. Describe how point mutations in the SARS-CoV2 spike protein might affect its function.Define α6β4 integrinSequence A: TCT/ TCC/ CTC/ CTA/ AAC/ GTT/ CAA/ CCG/ GTT/ CTT/ AAT/ CCG/ CCG/ CCA/ GGG/ CCC/ CGC/ CCC/ TCA/ GAA/ GTT/ GGT AGA Sequence B: TCA/ GAC/ GTT/ TTT/ GCC/ CCG/ TAA/ CAA/ CTT/ GTT/ ACA/ ACA/ TGG/ TCA/ TAA/ ACG/ TCA/ GAG/ ATG/ GTC/ AAT/ CTC/ TTA/ ATG/ ACT Sequence C: TAT/ ATA/ CAT/ GTA/ AAC/ ACA/ TAC / TCA/ GTG/ GAC/ CAA/ CTC/ AAC/ ATA/ AAC/ CAA/ ACA/ CCG/ CTC/GCG/ CCG/ AAA/ AAG/ ATA/ TGG STEP 1: Transcribe each of the 3 DNA sections into nRNA. Write out the complementary CODONS directly below the DNA strands. STEP 2: Clearly identify the three fragments as the FIRST, SECOND and THIRD fragments by clearly labeling any obvious PROMOTERS, START and STOP codons. STEP 3: Number the the START codon #1 and number the codons in the correct order until the STOP codon is reached. STEP 4: Codons 14- 64 (including 14 & 64) represent an intron. Draw a single red line through these codons to indicate that they will NOT be translated. STEP 4: In the space provided, write out the…
- Outline the events that occur when an F+ cell encounters an F- cellIn covid-19 myocarditis happened, and endothelial cell is in charge of inhibiting the inflammation, what will happen to the endocardium? It will be affected?HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)