b. CH CH2 | H;Č CH3 - Polypeptide backbone H3C CH3 ! CH C=OH -CH2+S-S CH2– а. CH2 -CH2-CH2-CH2–CH2-NH;* 0-C-CH2- d.
Q: A protein is allosterically regulated by a molecule. This molecule enhances the binding affinity, an...
A: Regulation in science refers to the adapted form or change in structure or function of any molecule ...
Q: 9. Compare the energy cost, in ATP equivalents, of synthesizing stearate from mitochondrial acety...
A: Stearate is a 18 carbon saturated fatty acid. Lets first look at the amount of ATP equivalents requi...
Q: 1.Would you expect a solution of high salt to be able to denature ribonuclease? Why or why not?
A: As there are multiple question you have asked that are not much interrelated to each other so accord...
Q: 1. Differentiate starch from cellulose and carb 2. In which solvents or solutions will a lipid be a....
A: Since, you have posted a question with multiple sub-parts, we will solve first three sub-parts for y...
Q: Please help me answer this in 10 sentences only. How can biotechnology help preserve the endangered...
A: The importance of wildlife to human welfare cannot be overstated. Wild animals are sources of money,...
Q: Classify characteristics of skeletal muscle energy metabolism by dragging each statement to its corr...
A: Oxidative phosphorylation This pathway requires oxygen Produces a significant fraction of ATP durin...
Q: cell wants to synthesize the a(1→4) dimer from two glucose molecules. Show the mechanism.
A:
Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H,N-C-COOH CH2...
A: Amino acids are the building blocks of proteins. The building blocks of living organisms are amino a...
Q: Two proteins bind the same ligand, and the data is shown below. Select the best answer based on this...
A: Lowest the KD value, greater will be the affinity of ligand to the protein. Highest the KD value, we...
Q: As homocysteine levels increases A. cardiac risk decreases B. cardiac risk increases C. cardia...
A: Heart along with the blood vessels (arteries, veins and capillaries) and blood comprises the cardiov...
Q: Explain why, glucose-6-phosphate will prefer to go via the pentose phosphate route. What additional ...
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic p...
Q: Define
A: Enzyme kinetic is a branch of Biochemistry. There are several factors that enzyme catalysis are depe...
Q: Briefly discuss the functions of the four types of biological molecules.
A: Four types of biological molecules include carbohydrates, proteins, fats/lipids, and nucl...
Q: 4. Which of the following substances is associated with Na+/K+ balance in the human body? a. Cortiso...
A: Thanks a lot for submitting the questions. As you have asked to answer only 4, 5, and 6. Please find...
Q: 7. Which set of the following amino acids are all polar? a. W K Q b. H M N c. T N Y d. M T C e. P C...
A: The side chains of amino acids are used to categorize them. Glycine (Gly), alanine (Ala), valine (Va...
Q: Kindly refer to the photo attached. thank you
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: 6. Which of the following statements concerning bile acids is incorrect? They are... a. Insoluble in...
A: Bile acids are steroid acids present in bile of mammals and vertebrates. These bile acids are conju...
Q: polecules used during process, purpose Fermentation & or Occurs when? cules produced during
A: The question is all about the fermentation cycle and glycolysis cycle. Both cycle contain some gases...
Q: Give one physiological c
A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the ...
Q: QUESTION 2 In a lab, you take 5 mL of of Stock solution and mix it with 5 mL of water to make soluti...
A: 5 ml stock solution present in solution A(10 ml) Solution B volume = 10 ml solution A+ 990ml water =...
Q: make the test principle, materials required for the analysis, sample preparation, test procedure, in...
A: A variety of organic compounds exist in nature. Among them, the nitrogen-containing organic compound...
Q: Why is there a need to filter the alkaline solution after adding the Barium chloride solution?
A: In an aqueous solution, barium chloride acts as a simple salt. However when dissolved in water, it ...
Q: The compound tetraethylammonium (TEA) blocks the voltage-gated changes in potassium permeability tha...
A: Action potentials are known to be the source of neuronal transmission, in the form of electrical sig...
Q: please provide a mechanism for how Pro-Thr-Pro-Ser amide could rearrange/molecule into a different m...
A: Amino acids are the building unit of proteins/polypeptide chain, consisting of amine group, carboxyl...
Q: The only sugar structure that does NOT contain chiral carbon atom a. Erythrose b. Erythroluse c. Gly...
A: Multiple questions asked. I can answer the first question, following the guidelines. Kindly repost o...
Q: SEE EXAMPLE IN THE IMAGE A mixture of 0.20M acetic acid and 0.30M sodium acetate is given. Calculate...
A: The Henderson Hasselbalch equation for calculation of the pH of a solution of weak acid and its conj...
Q: B. Calculate the concentration of the reducing sugar in the 50.0 mL sample in mg/mL. Apply Beer-Lamb...
A: A reducing sugar is any sugar that is capable of acting as a reducing agent.
Q: Sickle cell anemia results from a substitution of a valine for a glutamic acid. What do you expect t...
A: Sickle cell anemia: Normal red cells are round like doughnuts shape, but in sickle cell anemia, it ...
Q: Which of the following types of bonds are present in the primary structures of proteins? O Hydrogen ...
A: Proteins are composed of twenty standard amino acids attached together through amide bonds. These tw...
Q: ndicate what you would do and the observations you would expect for each case. Be explicit in your e...
A: Phenols are family of organic compounds characterized by a hydroxyl group attached to a carbon atom ...
Q: 3% red cell suspension using 0.5 mL of pRBC
A: The question is all about the preparation of 3% red cell suspension from 0.5 ml pRBC from the patien...
Q: Make a conclusion about the qualitative test on lipids You can use this as your reference: https:/...
A: Qualitative tests help to detect the presence of an unknown substance in a given sample. Presence of...
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the ...
A: The genetic code is the set of rules used for translation of the information encoded within genetic ...
Q: This is a reducing tetrasaccharide and is made up of 3 different monosaccharides True False
A: Given tetrasaccharide - Alpha(1,6) glycosidic linkage between 1st and 2nd monomer;2nd and 3rd monome...
Q: Draw the C-2 epimer of Ribose
A: Epimers are a pair of diastereomers, at one stereogenic carbon center of two epimers have at least...
Q: Explain how blood glucose can be maintained through the different pathways of carbohydrate metabolis...
A: Carbohydrates are the main source of energy for plants and animals. In plants carbohydrates are form...
Q: A 50.0 ml juice extract is colorimetrically assayed using Nelson's test. One milliliter (1.00 mL) of...
A: Answer: Principle: Nelson Somogyi method is a version of Somogyi'stitrometric method for use with ...
Q: Short-chain fatty acids such as butyrate are absorbed by the mammalian intestine and used as metabo...
A: Short chain fatty acids are the molecules having fatty acids with fewer than six carbon atoms.
Q: Why are some metabolic reactions coupled to the hydrolysis of ATP? To drive the nonspontaneous...
A: Metabolic reactions are involved during the metabolism of biomolecules like carbohydrates, proteins,...
Q: Why methylated spirit is used? Why the beaker with its content was kept in the dark raped Why methyl...
A: Methylated spirit is made up of ethyl alcohol and methyl alcohol. The composition of methylated spir...
Q: what is the purpose and objectives on doing nitrious acid test?
A: Amines are the compounds and functional groups having a basic nitrogen atom with a lone pair of elec...
Q: TRUE OR FALSE?
A: Metabolic pathways in living organism include series of enzyme-mediated chemical reaction that inclu...
Q: When combining 0.5 mL of Lysozyme solution (with a concentration of 10 mg/ml) and 0.5 mL of water, w...
A: Lysozyme is an enzyme which catalyzes the hydrolysis of peptidoglycans present in cell walls of bact...
Q: Why do steroid hormones not require signal transduction and second messengers to exert their actions...
A: Steroid hormones:- It is a group of hormones , belong to the class of chemical compounds known as st...
Q: From the complete oxidation of glucose (glucose → 6CO2), how many total nucleotide triphosphates are...
A: Glucose is metabolized through the glycolytic pathway to yield energy in the form of ATP and NADH. T...
Q: Ninhydrin Test Samples used: Egg Albumin Gelatin Dispersion Added reagent: Ninhydrin Solution ...
A: Ninhydrin is a general test for proteins and amino acids. It degrades amino acids into aldehydes, am...
Q: 1. A mother went to a drugstore to purchase a vitamin supplement for her baby. She found out from t...
A: Amino acids are the primary molecules that combine together to form the biomolecule proteins. These ...
Q: Which statement about N-linked glycosylation is correct? N-linked oligosaccharides are attach...
A: There are two types of glycosylation of protein – N Linked and O Linked In N-Linked glycosylation, o...
Q: Legend: Blue – wild-type β-galactosidase Red – mutant β-galactosidase _________ a. What is the...
A: The amino acid sequence of a protein determines the structure and hence the function of a protein. T...
Q: Phospholipase A2 causes the release of what fatty acid from membrane phospholipids? What chemical cl...
A: Phospholipase is an enzyme that breaks down phospholipids into fatty acids and other lipophilic comp...
In the following diagram of a portion of a protein, label the types of interactions that are shown.
- What level of protein structure are these interactions producing?
Step by step
Solved in 3 steps with 1 images
- н но- Н о CH ОН -H ОН CH₂OH Cu2+ (aq)Please label subparts as per: https://www.bartleby.com/questions-and-answers/2-3/a4e8137f-8ffd-4f93-ac94-ae6d805c0705HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)
- Hand written plz asap... I'll give you multiple upvote... Hand written plz asapWhat will happen to K-V-F-W-P-L-I-Y in the following treatments: a. Chemotrypsin treatment b. Trypsin treatment C. Pepsin treatment d. Thermolysin treatmentGive the correct names for the types of sugars shown below: a. b. CHO HO- -H € H- -OH CH₂OH HO- HO- HO- H- CHO -H -Ċ- -H -C-H -OH CH₂OH
- f. hemi- + -paresis my/o + -paresis ◆ dys- + -phasia hemi-+-plegia hemat/o + myel/o + ia ◆a- + -phasia hydro- + cephal-+ -us di- + -encephal/o + on meninge/o + myel/o + -cele a- + neur/o + ism muscle weakness a. b. localized dilation of a blood vessel difficult speech production C. d. lack of speech e. partial paralysis of one side of the body f. Paralysis of one side of the body hernia of the meninges and spinal cord g. h. part of brain that contains the thalamus and pit i. hemorrhage into spinal cord j. accumulation of CSF in the brainPLS,,, HELP ASAPP1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate V
- Do part d, e, f only thanksLetter D please what is called!TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG-T GA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-A TG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG-CTG- AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: USE "-" TO SEPARATE CODONS, NO SPACES) b. Determine the amino acid sequence after translation (USE TO SEPARATE AMINO ACIDS, NO SPACES): c. What are the Start and Stop codons in the mRNA?