Answer the following questions concerning sulfathiazole below by filling ieach blank with the appropriate response. N S: sulfathiazole The hybridization of the nitrogen atom in sulfathiazole is A. sp B. sp² C. sp³ B. sp2 A. sp C. sp3
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: How does the predicted molecular weight of AlaE (16949.07) compare with the molecular weight of the…
A: SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…
Q: [AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in…
A: Isocitrate dehydrogenase catalyzes the irreversible decarboxylation of isocitrate to yield…
Q: 14. Discuss the significant similarities and differences between Gram-negative and Gram-positive…
A: Some key similarities between Gram-negative and Gram-positive bacteria include:1. Cellular…
Q: In some microorganisms, carbon fixation occurs by reversal of the citric acid cycle. This reversal…
A: Change in standard reduction potential () is the standard reduction potential of the electron…
Q: What value of [S], as a fraction of KM, is required to obtain 80% of Vmax? (Hint: use the MM…
A: We need to use the Michaelis-Menten (MM) equation shown below to solve this question.
Q: All blood groups are True False composed of glucose, fucose and N-acetylglucosamine
A: ABO blood typing is a lab test performed to categorise human blood into four groups based on the…
Q: 11. A polypeptide is making a short a-helix. A typical residue in an a-helix is involved in two…
A: In an alpha helix, each amino acid residue forms hydrogen bonds with the amino acid located three…
Q: You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, ẞ-…
A: Proteins precipitate at specific concentrations of various salts. The concentration of salt required…
Q: s) In two experiments carried out in a research lab, an enzyme reaction is run with and without an…
A: Enzymes are proteins that catalyze biochemical reactions. They contain an active site where the…
Q: Parts of the mechanism for lysozyme are shown below. The catalytic lysozyme residue side chains can…
A: Lysozymes cleave the glycosidic bond between N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine…
Q: I JUST WANTED TO NOTE THAT OPTION C IS 100% WRONG AND YOU CAN ONLY CHOOSE ONE OF THE OTHER 4 OPTIONS…
A: The DNA double helix's structural characteristics and interaction sites are described by the…
Q: What percentage of max is obtained when the substrate is present at 80% of the Km? Use two digits in…
A: is the maximum velocity attained by an enzyme during a reaction. is the substrate concentration at…
Q: Draw the structure of phosphatidylcholine at pH 7 with the moiety on R₁ as 14:0 (C14) and R₂ as…
A: Glycerophospholipids, membrane lipids in which two fatty acids are attached in ester linkage to the…
Q: If the fermentation reactions starts out with a pH of 6.7 and the final pH is measured as 5.5 a…
A: The equation of this reaction can be written as C12H22O11(lactose) +H2O ----------->…
Q: Which of the following statements regarding Michaelis-Menten kinetics is TRUE? The ES complex can…
A: According to Michaelis Menten the MM) equation, the rate and velocity of enzyme catalyzed reaction…
Q: 6. What is the catalytic triad and what particular protein family would you find this? What is the…
A: Serine proteases are protein cleaving enzymes that have Serine, Histidine and Aspartate (the…
Q: Which of the following is not a carbohydrate? a. C3H603 Ob. C50H100050 c. C6H806 d. C4H804
A: Definition of Carbohydrates: Carbohydrates are organic compounds made up of carbon, hydrogen, and…
Q: Problem 3
A: The objective of the question is to determine the genetic distance between two genes, F and G, in…
Q: d. e. fo HO -OH NH2 n blood HO n H3C SCOA OH HO NH CH3
A: Reactions mechanisms are basically jumping of electrons within and between the reactants. Based on…
Q: ou are studying the tripep de Lys-Val-Thr. a) Could you use the absorbance at 280 nm to determine…
A: Protein concentration can be determined using spectrophotoscopy. Here, the absorbance of a protein…
Q: Genetics Question 9
A: The objective of the question is to identify the event that occurs last during meiosis and the…
Q: Part 1. In dilute acid, hexoses exist in equilibrium with the corresponding 1,6-anhydrosugars. For…
A: One or more water molecules have been removed from sugars, which are known as hydro sugars. One…
Q: 1. In a study by Cameroni et al. (Nature, Dec. 2021), scientists analyzed the interaction between…
A: SARS-CoV-2 is an infectious virus that is responsible for the recent COVID pandemic. It is a…
Q: (5) s) Consider the equation for enzyme action below: E-S E-P E+S complex E+P complex Briefly…
A: Catalyst are chemical compounds that speed up chemical reactions but do not undergo any changes…
Q: 3A.Describe the difference in biological func on of myoglobin and hemoglobin in the body. How does…
A: Myoglobin and hemoglobin are both proteins involved in oxygen transport within the body, but they…
Q: You have expressed a protein of interest in E. coli cells for further study in the lab. The protein…
A: One possible purification scheme for the protein of interest might include the following steps:1.…
Q: Q1) a) Draw the absorbance spectra for the following DNA samples. a. Pure DNA without protein…
A: “Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…
A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…
Q: Genetics Question 8
A: The objective of the question is to identify the correct event that occurs during the prophase of…
Q: Identify which one among the 6 carbohydrates; Glucose, fructose, maltose, lactose, sucrose or starch…
A: CarbohydratesMolisch TestBenedict's TestSeliwanoff's testlodine testBial's testMucic acid…
Q: Construct the two enantiomeric forms/structure of the following monosaccharides and designate the…
A: Monosaccharides are simple sugars, the basic units of carbohydrates. There are two types of…
Q: 4nM 10 μΜ Ο 0.01 nM Ο Ο Ο 2 nM -2 nM
A: A Hill Plot is a type of graphical representation used in pharmacology and biochemistry to show how…
Q: For the following reaction: HNO3 H2SO4 NO2 NO2 NO2 10% 8% 82% 1. Write a reasonable mechanism, using…
A: 1) isopropyl benzene is considered to be electron donating by positive inductive effect of its…
Q: A) H H₂N-C-C <=0 CH2 OH ОН н D) H2N-C-C <=0 CH2 OH HO CH3 B) H₂N-C H3C-CH CH2 CH3 0= OH E) H2N-c-c С…
A: Amino acids are simply an alpha-carbon bonded to 4 different groups. The 4 groups are;an alpha-amino…
Q: Suppose the concentration of glucose inside a cell is 0.4 mM and the cell is suspended in a glucose…
A: The following equation describes the mathematical relation for the change in free energy (ΔG)…
Q: If the membrane potential of a neuron drops to -55mV and sodium ions start to flow from outside to…
A: Concentration of ion gradients across a membrane and selective movements of ions along gradient…
Q: Label each Amine (A–D) in Table 1 as primary, secondary, or tertiary. Which classes of amines –…
A: Good evening,Hope this helps, Thank you!Explanation:Approach to solving the question: Detailed…
Q: The peptide below H3N-CH- I NH–CH -NH-CH -NH-CH CH3 CH2 CH2 CH2 CH2 H₂C-CH HỌCH, NH–CH CH2 OH -OH…
A: Peptides are composed of amino acids. Ionizable groups in a peptide are the N-terminal alpha-amino…
Q: How many TCA cycles required to fully oxidize 1 molecule Acetyl-CoA. Support your answer with…
A: There are two oxidizable carbons in acetyl-CoA; the methyl carbon (CH3-) and the carbonyl carbon…
Q: sickle cell anemia
A: Sickle cell anemia (SCA) is a genetic disorder identified by abnormal red blood cells. Genetic…
Q: BIOMOLECULES - Please answer the questions properly. - Multiple choice 1. Which of the following…
A: OPTION A : It outlines an enzymatic two-step mechanism that converts AMP to ADP and subsequently ADP…
Q: Several general characteristics of metabolic reactions or reaction pathways are listed. Classify…
A: Metabolism is the sum total of all chemical reactions taking place in an organism. It can be…
Q: Problem 1
A: The objective of this question is to identify the non-recombinant mice from a cross between FG/fg…
Q: Q5. Each ionizable group of an amino acid can exist in one of two states, charged or neutral. The…
A: Amino acids are simply an alpha-carbon bonded to 4 groups. The 4 groups are;an alpha-carboxyl group…
Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…
A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…
Q: A partial diploid in E. coli is created so that LacI is no longer expressed from the genome and is…
A: Partial diploid E.coli has both chromosomal DNA (i.e. genome) and plasmid DNA, but all the genes are…
Q: 250 150 2 -250 150 100 -100 75 -75 50 -50 37- 37 25 20 15 10 Std Calf Fibrinogen BSA Std Biorad…
A:
Q: 2. Draw the ringed form of D-glucose with the following modifications: (a) Convert to sugar acid at…
A: Below answer given Explanation:Step 1:(A) Step 2:(B)(C)&(D) Step 3: Step 4:
Q: Describe how the SCAM analysis was performed so that it maintains replicatability.
A: SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…
Step by step
Solved in 2 steps
- From the following monosaccharides, identify the a anomers. Select all that apply. Select one or more: OH он OH OH O a. OH OH HO но- Ob. ÓH H OH HO но- он H OH O c. HO OH ÓH ÓH d.This is remdesivir, one of the drugs being used in the treatment of COVID-19. Label the indicated carbons as R, S, or neither. b); NH2 HO OHDefine the following: 1. Cofactor 2. Coenzyme 3. "-ase" ending
- An amino acid mixture consisting of lysine, leucine, and glutamic acid is to be separated by ion-exchange chromatography, using a cationexchange resin at pH 3.5, with the eluting buffer at the same pH. Which of these amino acids will be eluted from the column first? Will any other treatment be needed to elute one of these amino acids from the column?One of the main sources of sphingosine in the body is in the cell membrane. What complication could arise from the biological synthesis of ceramide?In ion-exchange chromatography, amino acids are separated on the basis of electro-static interactions and hydrophobic interactions with the resin. The chemical structure of the resin pol-ymer with a negatively charged sulfonic acid group is shown to the right. An elution profile for the aminoacids using this resin is given below. Based on the elution profile above, explain the following:
- A prescription calls for 4 mg of atropine on a balance where 180 mg is the least weighable quantity with the precision desired. What amount will provide the 4 mg correctly, using lactose as the diluent?An amino acid mixture consisting of lysine,leucine, and glutamic acid is to be separated by ion-exchangechromatography, using a cation-exchange resin at pH 3.5, with theeluting buffer at the same pH. Which of these amino acids will beeluted from the column first? Will any other treatment be neededto elute one of these amino acids from the column?Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest experimental pH range used to seperate an amino acid mixture consisting of Ala, Cys and His Starting pH: Ending pH:
- Based on this video https://www.youtube.com/watch?v=rKng5-ij6kQ Provide a schematic diagram for the Iodine test methodologies in determining the presence of carbohydrates. Also, give the basic principle for the test.Cyanogen bromide is a common sulfhydryl-modifying reagent that can generally be used to break disulfide bonds. True FalseFatty acids are isolated using a surface embedded with silver ions. The composition of a fatty acid mixture was identified,and the shorthand notations of the fatty acid and triglyceride names were identified.Sample A – 18:0Sample B – trans-18:1∆9Sample C – cis, cis-20:2∆9, ∆12Sample D – 1,2-dibutyroyl-3-caproyl glycerolSample E – 1,2-dioleoyl-3-linoleoyl glycerolSample F – phosphatidylcholineWhich among these fatty acids and triglycerides, respectively, will MOST LIKELY be isolated by the described surface?Illustrate the condensed and skeletal structures of your answer(s). Provide a ten-sentence explanation to justify youranswers using relevant chemistry concepts.