A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
Q: Which of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B)…
A: Amino acids are classified based on their properties like whether they are polar or nonpolar,…
Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…
A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: Small molecules called amino acids form the building blocks of proteins. In chemistry, an amino acid…
Q: Identify and briefly describe three different PEGylation strategies you can use to PEGylate this…
A: The process of PEGylation improves drug solubility and decreases immunogenicity of a molecule that…
Q: What is the difference between a deoxynucleotide triphosphate (dNTP) and a dideoxynucleotide…
A: dNTPs are also called deoxyribonucleotide triphosphate. Each dNTPs are made up of a phosphate group,…
Q: Choose ALL of the charged (+1 or -1) amino acids at aqueous physiological conditions where the ph=…
A: Amino acid is the basic structural unit of proteins. They contain an amino group, a carboxyl group,…
Q: Write the structure of each of the following peptides. Start with the N-terminal and the COO- on the…
A: Peptides are the sequence of amino acids that are joined through formation of peptide bond. The…
Q: Hydrolysis of dodecapeptide P with the enzyme trypsin affords the following fragments: Glu-Ala-Lys,…
A: Trypsin cleaves the dodecapeptide at the carboxyl side of Lys or Arg. Chymotrypsin cleaves the…
Q: Would the side chains in the Leu-Thr-Met-Val-Trp-Gly-Pro of a polypeptide be located on the interior…
A: 1.Amino acids that are hydrophobic (water-fearing) in nature are mostly found interior of the…
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin,…
A: Proteolytic cleavage is basically the process of breaking the peptide bonds between amino acids in…
Q: What is the base sequence of the segment of DNA that is responsible for the biosynthesis of the…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: For each of the following sequences determine if they will most likely form an amphipathic α helix,…
A: Proteins are polymers of amino acids. The sequence of amino acids is governed by the sequences of…
Q: Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal…
A: Sequencing of proteins is done by treating Proteins with different enzymes that have specificity in…
Q: Show where trypsin and chymotrypsin would cleave the following peptide…
A: Amino acids are joined together by a peptide bond to form a polypeptide chain called protein.…
Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…
A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…
Q: A tetradecapeptide (14 amino acid residues) gives the following peptide fragments on partial…
A: Peptides or proteins are composed of amino acids linked together via peptide or amide bonds. Protein…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: Determine the codon sequence for the peptide sequence glycylserylcysteinylarginylalanine. How many…
A: Translation is the sequences process where the mRNA was translated into a polypeptide chain. Where…
Q: Consider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu…
A: Trypsin breaks down proteins in the duodenum into smaller peptides. Other proteases would further…
Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…
A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly…
A: Trypsin and chymotrypsin are essential serine proteases that are secreted by the pancreas. They play…
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: The primary structure of the protein refers to the amino acid sequence in the peptide. The amino…
Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…
Q: A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the…
A: Chromatography is a useful technique to study the separation of amino acids. Paper chromatography is…
Q: Identify and briefly describe the different PEGylation strategies you can use to PEGylate this…
A: PEGylation refers to the process where polyethylene glycol polymer is chemically added to a protein…
Q: A solution of a peptide of unknown sequence was divided into two samples. One sample was treated…
A: Only twenty of the available amino acids are often present in proteins among all the possible amino…
Q: Draw the structure of the PTH derivative product you would obtain by Edman degradation of the…
A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…
Q: Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-…
A: Most common secondary are the α-helix and the β-pleated sheet. Both the secondary structure is…
Q: Identify the primary sequence for the polypeptide that yields these fragments upon treatment:…
A: Proteins are the macromolecules composed of amino acids bound together by peptide bond between amino…
Q: The following data describe the catalysis of cleavage of peptide bonds in small peptides by the…
A: The enzymes that cleave the peptide bonds are known as proteases. There are many types of proteases…
Q: Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following…
A: An amino acid is a natural atom that is comprised of a fundamental amino gathering (−NH2), an acidic…
Q: Two melanocyte-stimulating hormones have the following amino acid sequences. Take a highlighter or…
A: Conserved sequences are the amino acid sequence that remain identical between two or more species…
Q: Which of the following peptides would reach the positive electrode first if placed in an…
A: in a polyacrylamide gel electrophoresis, proteins are loaded in a vertical gel so that they can be…
Q: A number of fragments that will be formed by cleaving the peptide Met-Ala-Lys-Met-Arg-Phe-Met-An by…
A: Proteins are one of the macromolecules present in the body. They provide structural support,…
Q: Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after…
A: Introduction- N-terminal methionine cleavage plays an important role in protein synthesis in…
Q: Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide…
A: The amino acids that form peptide chains can be either polar/non-polar, charged/uncharged,…
Q: For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids?…
A: mRNA is also called as messenger molecule which is produced by RNA polymerase. The mRNA is produced…
Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…
A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…
Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…
A: Answer :- Met-ala-phe-lys-stop DNA…
Q: Consider a hexapeptide of the sequence thr asn glu trp lys gln. A researcher decided that this…
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: Please propose a method to synthesize the following peptide. Leu.Gly.Ala (automated synthesis…
A: Automated solid-phase peptide synthesis (SPPS) is a technology that is suitable technology in order…
Q: Draw and label the following RNA tetranucleotide: 5'phosphoryl-A-2'O-methyl-C-U-G-3'- phosphate.
A: A tetranucleotide is sequence of four base pairs in RNA (ribose nucleic acid) is known as RNA…
Q: Three peptides were obtained from a trypsin digestion of two different polypeptides. indicate the…
A: Three peptides were obtained from trypsin digestion of two different polypeptides.
Q: Describe the chemical difference between mannose and heptyl alpha-D-mannose. Why does FimH have a…
A: Mannose is a type of the monomer of the sugar. Mannose can be produced in the human body and it can…
Q: If a polyribonucleotide contains equal amounts ofrandomly positioned adenine and uracil bases, what…
A: Polynucleotide with ribonucleotides as mononucleotides is known as a polyribonucleotide. Nucleic…
Q: After gel electrophoresis, it is common to extract a protein (or proteins) from a band in the gel,…
A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first…
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Polypeptide is formed when amino acids are joined together with peptide bonds. Peptide bond is…
Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…
A: The sequence are:
A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBRTreatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide.Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide. I don't understand how the order of amino acids in Step 2 was arranged. Please explain. Thank you.
- Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-ArgA sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin, and the other with cyanogen bromide. Given the following sequences of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment: Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen Bromide treatment: Gln-Phe Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met
- The following steps were performed using enzyme cleavage of a peptide to determine its amino acid sequence. Step 1. FDNB yield DNB-Gly Step 2. Treatment with trypsin yield 3 fragments: Tyr-Leu-Asp-Arg; Gly-Ser-Ala-Lys; Trp-Gly-Ser-Met Step 3. Treatment with pepsin gave the same 3 peptide fragments. What is the sequence of the peptide?Show the peptides that would result from cleavage by the indicated reagent: a. Val-Arg-Gly-Met-Arg-Ala-Ser by carboxypeptidase A b. Ser-Phe-Lys-Met-Pro-Ser-Ala-Asp by cyanogen bromide c. Arg-Ser-Pro-Lys-Lys-Ser-Glu-Gly by trypsinA polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?
- Given the peptide Val-Ser-Gln-Lys The lateral chain of one of these amino acids can be modified by N-acetylation. Write the semi‐developed form of the lateral chain of this modified amino acid at pH 7 The lateral chain of one of these amino acids can be modified by phosphorylation. Write the semi‐developed form of the lateral chain of this modified amino acid at pH 7.A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).A peptide with the primary structure Lys-Arg-Pro-Leu-Ile-Asp-Gly-Ala must be synthesized by the methods developed by Merrifield. Calculate the percentage of the peptides synthesized that will be full length and have the correct sequence if the addition of each amino acid residue is 96% efficient. Do the calculation a second time but assume a 99% efficiency for each cycle. full-length peptides with the correct sequence if 96% efficient: full-length peptides with the correct sequence if 99% efficient: % %