A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below. 5’ – C T G T A T A C G T T A – 3’
Q: Why marathon runners eat a meal rich in carbohydrates the day before the race
A: Nutrients are molecules that aids in the growth and development of living organisms. Nutrients are…
Q: (b) The results in the table below were extracted from clinical reports of pediatric age infants (3…
A: Pyruvate Dehydrogenase (PDH) complex contains 3 enzymes within it. Hence they are commonly referred…
Q: CH2OH OH HO, CH2OH OH OH OH ÓH Enatiomers Diastereomers O Epimers Anomers
A: When two monosaccharides differ from each other in their configuration around a single specific…
Q: Modified true or false. If false, replace the underlined word with the correct answer.
A: Glycolysis is a metabolic pathway, through which the glucose molecules are metabolized to synthesize…
Q: Complete the following chart about PDHK activity by determining if the molecule would be in high or…
A: Pyruvate dehydrogenase kinase stands for (PDHK). This PDHK belongs to the kinase enzyme family.PDHK…
Q: Consider 3 molecules of galactose: (write only the whole number; no decimal places) a. How many…
A: Galactose is an aldohexose sugar. The galactose unit is found in the milk sugar known as lactose.…
Q: What are the main functional groups present in carbohydrates? Illustrate and explain.
A:
Q: Properties of Body Fluids.
A: "Since you have posted multiple questions, we will answer the first question for you. If you want…
Q: On average, 180 liters of plasma are filtered each day. A If humans had to expend one molecule of…
A: An important "energy molecule" found in every living organism, adenosine 5′-triphosphate is…
Q: A muscle cell structural element that is composed of several hundred myosin molecule is a/an…
A: Introduction: Skeletal muscle is a type of striated muscle that is attached to the skeleton. Our…
Q: To set up a standard curve you would have had to set up a dilution series. Draw up a table showing…
A: Serial dilution is the process of converting a dense solution towards a more useable concentration…
Q: What is phenylketonuria? Discuss its occurrence, symptoms if any, treatments if there are, and any…
A: The pattern of inheritance of a condition caused by a recessive faulty gene copy located on an…
Q: In bacteria, single polycistronic mRNA encodes for: a single mRNA which is split into…
A: Polycistronic mRNAs are those that code for many polypeptides from a single mRNA as it involves…
Q: Which of the following CHÍNH, CH HO CHÁNH, CH₂OH I CH H₂N both a and b neither a nor b CHÍNH
A: Stereochemistry is also known as the subdiscipline of the chemistry. Stereochemistry involves the…
Q: Table Q1(a) shows typical values for the intracellular and extracellular concentrations of the major…
A: All cells have an electrical potential difference or membrane potential across their plasma…
Q: Calculate the energy produced (in ATP molecules) achieved by complete oxidation of the hydrolysis…
A: Carbohydrates are the primary energy source for most organisms. Carbohydrates are digested to…
Q: List possible glucogenic products of amino acid degradation
A: Aminoacids are classified into two types based on their fate of conversion to glucose or ketone…
Q: Trace the pathway of a protein from translation to the plasma membrane. You may name this protein…
A: Membrane proteins are a part of membrane structure, which are very important for a cell to carry out…
Q: In sickle cell anemia, an inherited form of anemia in which the hemoglobin distorts the red blood…
A: The mutation that alters the codon that codes for a specific amino acid is called missense mutation.…
Q: Which of the following enzyme is responsible for the regulation of biological nitrogen fixation? A.…
A: Nitrogen fixation is biochemical process by which molecular form of nitrogen with triple covalent…
Q: Which of the following is NOT one of the products of the pentose phosphate shunt?
A: The pentose phosphate pathway is the one important metabolic pathways which is take place in most of…
Q: Does different kinds or types of tea produces different amount of caffeine content? Why? Why does…
A: Caffeine is categorized as a type of a bitter substance. The caffeine occurs in a number of…
Q: Draw the Haworth Projection or the cyclic structure of the following:
A: organic compound organized in the form of aldehydes or ketones with multiple hydroxyl groups coming…
Q: Gel Filtration Chromatography Affinity Chromatography SDS-PAGE
A: The branch of biology completely focuses on studying the various biological life processes at…
Q: 8. A paticnt sullering from infectious polyarthritis, has been reeciving prednisone for a long time…
A: Prednisone is a kind of glucocorticoid. It is a prodrug, which means the liver converts it to…
Q: One indication of the relative importance of various ATP-producing pathways is the Vmax of certain…
A: The energy content of fat per gram is greater than that of glycogen. The tissue's ability to…
Q: 87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Q2-A man (weight 65) ate a daily diet containing 65 g protein. So in a week, he weighed himself and…
A: Protein efficiency ratio - is the ratio of based on the weight gain of a unknown subject divided by…
Q: n order to avoid wasting cell resources, feedback mechanisms to regulate enzyme activity are a…
A: A chain of chemical reactions where constant synthesis and degradation of the product occur in…
Q: Based on the knowiedge you gained from the cloning module, which of the lanes in th firure is…
A: PCR stands for a polymerase chain reaction. It helped in the lab to make millions of copies of a…
Q: Explain how do you prepare a 25-mL solution of 1 mg/mL cholesterol stock?
A: Given Values: Volume = 25 ml Concentration = 1 mg/ml
Q: Select all the true statements about sequential versus concerted models of allostery. Group of…
A: Allostery is a property of biological molecules of transmission of the effect of binding from one…
Q: describe strategies that are used to manage insect resistance in genetically modified (GM) crop
A: It is estimated that about 15% of world's crop yield is lost to insects or pests. The damage is…
Q: d. Rise in levels of ADP Circle one: Increase rate of glycogenolysis Decrease rate of glycogenalysis…
A: Glycogenolysis is a biochemical pathway in which glycogen breaks down into glucose-1-phosphate and…
Q: Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide…
A: In the given data pKa of amino acids Thr-Asp-Arg is: Thr-? Asp-3.86 Arg-12.48 N-terminal group-…
Q: 10. Which of the following sequences would you expect to be a part of a beta turn? O PAAG O PAGA O…
A: Beta- turns are the simplest secondary structure, connecting two helices or sheets. They are…
Q: Problem 2. Competitive inhibitors are commonly used to make pharmaceuticals. Some cancer drugs act…
A: We need to plot the Lineweaver Burk Plot (LB Plot) to solve this problem. So first we need to find…
Q: Which of the following is not a general description of the gene expression regulation mechanisms…
A: Gene expression regulation mechanisms helps to maintain the rate of gene expression or to regulate…
Q: A drug was developed to inhibit the electron transport chain. How many ATP(s) would be generated by…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: Which of the following is NOT produced during the oxidative phase of the pentose phosphate shunt? a…
A: Pentose phosphate shunt is a metabolic pathway that is involved in the synthesis of pentose sugar…
Q: Which of the following reactions is the most exergonic? a Conversion of PEP to Pyruvate b…
A: Exergonic reaction is the reaction in which energy is released when reactants are converted to…
Q: Please answer post lab question and give a conclusion about the experiment
A: Browning of potatoes is caused by the polyphenol oxidase enzyme. In the presence of oxygen, the…
Q: Enumerate the pathways involved in the metabolism of carbohydrate and give a brief description to…
A: Metabolism of carbohydrates is a biochemical process which involves metabolic breakdown, formation…
Q: How do erythrocytes produce ATP? What is the role of ATP to red-cell morphology and function? 2. How…
A: Adenosine triphosphate (ATP) is an energy-carrying molecule particularly found in the cells of all…
Q: Categorize the electron carrier by the number of hydrogens that it can transfer in a single…
A: In the process of electron transport, one or more molecules accept electrons from another and donate…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: An inhibitor "I" is added to the enzymatic reaction at a concentration of 1.0 g/L. The data obtained…
A: The reciprocal kinetic data is as follows: 1/[S] L/g 1/V (min-L/g) E = 0.015 g/L (Without…
Q: 9. What do HDL and LDL stand for? 10. Considering HDL and LDL, which is considered "bad cholesterol"…
A: Lipoproteins are substances that carry cholesterol through your bloodstream . They are made up of…
Q: olysaccharides are healthier for the body than mono- or disaccharides are. What choices could you…
A: Starchy carbohydrates are also referred to as polysaccharides. Rice and potatoes are examples of…
Q: SCIENTIFIC PAPER INTRODUCTION ONLY- Titrimetric analysis of amino acids.
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are composed of…
A) Draw the structure and give the name of a
B) Write the complementary base sequence for the matching strand in the DNA section shown below.
5’ – C T G T A T A C G T T A – 3’
Please answer both parts
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- How many kilobases of the DNA strand below will code for the protein product?Draw the chemical structure of a dinucleotide composed of A and G. Opposite this structure, draw the dinucleotide composed of T and C in an antiparallel (or upside-down) fashion. Form the possible hydrogen bonds.A DNA sample contains 21% adenine. What is the complete percentage base composition?
- Draw the following structure. 1)A single strand of DNA with the sequence 5' GCAT 3'1) a) Sketch an A-form helix and a B-form helix, highlighting the differences between them. Indicate the bases and backbone as lines. Label the major and minor grooves. 2) Sketch a ribose in the pucker that is expected in RNA. 3) Sketch a 2’ deoxyribose in the pucker that is expected in DNA. 4) Draw a GCG triplet (GC Watson-Crick), with perfect geometry. Draw the bases only, with dR’s at the N-9 positions of the purines (Gs) and at the N1 positions of the pyrimidine (C)Place an asterisks (*) next to the 3' carbon atoms in the polynucleotide shown. -O CH₂ HOHDH Guanine -O-CH₂ H H H Thymine =P-O-CH₂ H OH Answer Bank H H Cytosine
- Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotideGiven the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’ a. Write the sequence for the complementary DNA strand. b. Write the sequence of the RNA complementary to the strand showndraw a picture of a SINGLE strand of DNA (a polynucleotide) composed of 9 (nine) nucleotides of your choice. Do use ALL 4 nucleotides. Use 3 simple symbols to represent the phosphate, the sugar, and the base in each nucleotide. For example, use a circle with the letter “P” for the phosphate in the backbone, a square with the letter “S” for the sugar in the backbone, and a triangle with the letter “A, T, C or G” for the bases.As you draw the diagram be sure to put solid lines for the covalent bonds you are creating to join new nucleotides to the elongating DNA chain.
- Draw the structure and give the name of a nucleotide made of adenine (A) and deoxyribose.Label each statement about the polynucleotide ATGGCG as true or false. a. The polynucleotide has six nucleotides. b. The polynucleotide contains six phosphodiester linkages. c. The nucleotide at the 5 ' end contains the base guanine. d. The nucleotide at the 3 ' end contains the base guanine. e. The polynucleotide could be part of a DNA molecule. f. The polynucleotide could be part of an RNA molecule.For each term in the left column, select the term which best matches. 1. deoxyribonucleotide 2. nitrogenous base thymine + deoxyribose 3. deoxynitronucleoside guanine + deoxyribose + phosphate group 4. polydeoxyribonucleotide DNA 5. deoxyribonucleoside 6. nitrogenous base