Which two restriction enzymes could be used to cut this DNA sequence? AATGCCAACTCGAGATAGCGCATATCTAGATTTGCA Xhol, Xbal Hindill, BamHI OHindill, EcoRI Sacl, Pstl
Q: histidine
A: Histidine, an essential amino acid, fulfills diverse roles in biological systems, demonstrating…
Q: The bonds that hold a cytoskeletal polymer together are best described as... -Covalent,…
A: The cytoskeleton is a network of different protein fibers that provides many functions: it maintains…
Q: A mutation of Lysine to Alanine in the middle of TM1 has been associated with increased GPCR…
A: The lipid bilayer is a thin polar membrane. It is made up of two layers of lipid molecules. The…
Q: acetyl CoA
A: Acetyl CoA is a central metabolite that plays important roles in energy production as well as…
Q: 1. The following data were obtained for a competitive inhibition study in which the [I] = 3 µM for…
A: In competitive inhibition, only the apparent Km is affected (Km,app> Km),The Vmax remains…
Q: On the paper provided, draw the chemical structure of a peptide with a sequence LEMD at pH 7. The…
A: Here, we are given the peptide LEMD. There are 4 ionizable groups in the peptide. They…
Q: (Theme 5) You are testing the role of three proteins (Protein A, Protein B, and Protein C) which…
A: The electrophoretic gel electrophoresis mobility shift assay is also known as EMSA.This assay is…
Q: What is the role of his 12 in the RNase-catalyzed hydrolysis of RNA, as indicated i the Figure…
A: Enzyme deploy different chemical mechanisms to catalyse biochemical reactions. One such mechanism is…
Q: 4. Two common buffers in biological research are PBS and TBS. What are the compositions of these…
A: Hello! Thank you for the question. Due to time constraints, we will be able to provide the solution…
Q: Yo₂ 1.0 0.8 0.6 0.4 0.2 0 Weak-binding 20 Transition from weak- to strong-binding Strong-binding 40…
A: The protein hemoglobin is a molecule which is responsible for carrying almost all of the oxygen in…
Q: #1 н Н 1. Name of molecule #3 Н N-с-с CH H.C CH3 3. Name of molecules Н но CH2OH Н OH он Н 6. Name…
A: There are four classes of biological macromolecules; proteins, nucleic acid, lipids and…
Q: Consider the graph below. Reaction rate (v) Vmax 0 Effector 3 mM Effector 1, mM Control 0 mM Ko.5…
A: Enzymes are biological catalysts that increase the rate of biochemical reactions.Most enzymes are…
Q: Within the body, CoQ 10 can be found in an oxidized or reduced form (also known as ubiquinone and…
A: ATP is synthesized via oxidative phosphorylation.Substrates such as glucose, citrate etc are…
Q: During our experiment, Sucrose tested positive for Benedict's Test. Benedict's test us actually a…
A: There are four classes of biological macromolecules- nucleic acid, proteins, lipids and…
Q: Consider the transport of K+ ions from a surrounding fluid (where [K + ] = 30 mM) into a cell (where…
A: The Nernst equation is a general equation that relates the Gibbs free energy and cell potential in…
Q: 8. 8. Metabolite name: 9. Metabolite name: 10. Metabolite name: 9. NADH NAD+ Glutamate…
A: The mitochondrial matrix undergoes a sequence of enzyme-catalyzed events known as the Krebs cycle,…
Q: NAD in its reduced form is symbolized as Select one: O a. NAD. O b. NAD. O C. NADP+. O d. NADP.…
A: Reduced form of a substance or molecule is the form that has gained electrons or hydrogens in a…
Q: In the presence of rotenone, there would be would be oxidized. reduced. fewer more electrons than…
A: A Mitochondria is a double membrane organelle of the cell. It is also known as the power house of…
Q: Describe the structures of glutamine and alanine. What are the characteristics of the R-groups?…
A: There are four types of biological macromolecules: nucleic acid, proteins, lipids and…
Q: Please explain the significance of the metabolites that served as inhibitors (CTP) or activators…
A: Pyrimidines are nitrogenous bases found in nucleic acids. Pyrimidines are heterocyclic organic…
Q: The purified OXA-M290 enzyme can now be tested to determine which β-lactamase inhibitor is most…
A: Beer Lambert's equation relates the concentration of the analyte to the absorbance value recorded by…
Q: 3. Answer the following problem and explain your answer for better understanding Which of the…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbons to 36 carbons.…
Q: Select the statements that describe genomic DNA libraries. DNA fragments are cloned into vectors.…
A: DNA libraries are catalogs of genetic information. DNA libraries are of different types, the two…
Q: Electron transfer translocates protons from the mitochondrial matrix to the external medium,…
A: The objective of the question is to understand the proton concentration in the mitochondrial matrix…
Q: 1. Answer the following problem and explain your answer for better understanding Which of the…
A: They are the simplest form of fats that are linear unbranched chains of CH2 groups linked together…
Q: Give the number of the reactions(s) of the citric acid cycle that reduce FAD give the order number…
A: The citric acid cycle is the most active pathway in aerobic lifeforms that is responsible for…
Q: Liquid hexane (CH,(CH₂) CH) will react with gaseous oxygen (0.) to produce gaseous carbon dioxide…
A: Mass of hexane = 18.g Mass of oxygen gas = 32.6 gMinimum mass of hexane left over by the chemical…
Q: Based on the sugar, would this nucleotide be part of an RNA or DNA polymer? ++ 00 RNA ODNA NH,…
A: A nucleotide is the essential structure of nucleic acids like DNA and RNA. It comprises of three…
Q: All of the following statements about the B-oxidation pathway are true except: The pathway is…
A: In metabolism, β-oxidation is the catabolic process by which fatty acid molecules are broken down.…
Q: fatty acid
A: Given Structure:The provided structure represents a fatty acid featuring an omega-3 double…
Q: Differentiate the advantages and disadvantages of messenger ribonucleic acid (mRNA) by RT-PCR and…
A: Cytokines are small signaling proteins that undertake both paracrine and endocrine signaling by…
Q: Discuss the effect of EDTA on ca absorbance in AAS experiment
A: EDTA stands for Ethylenediaminetetraacetic acid, is a type of anticoagulant which prevents the blood…
Q: 3. Read the article "An update of the chemiosmotic theory as suggested by possible proton currents…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) has been…
Q: Give a possible nucleotide sequence for the template strand of the gene that codes for this…
A: There are four classes of biological macromolecules - nucleic acids, proteins, lipids and…
Q: Fill the sentence in with the right keyword: Anabolic reactions Sometimes or Alwasys consume energy.
A: When a chemical reaction takes place energy is either taken in or released. Depending on the…
Q: 8H17NO2 is heated, and a condensation reaction occurs. A new molecule containing one peptide bond is…
A: The question is related to the skeletal structure of the peptide bond.The peptide bond is -C(O)-NH-…
Q: The KM for the reaction of chymotrypsin with Substrate A is 8.8 x 10-4 M, while the KM for the…
A: The Michaelis Menten constant (KM) can be used as a measure of the enzyme's affinity for its…
Q: Question 1. What is the O₂ saturation in the lungs? 2. What is the O₂ saturation in tissues at rest?…
A: We can find the O2 saturation % of hemoglobin at various conditions in various organs of the body…
Q: In hepatocytes, glucagon signaling leads to release of select one, which leads to the activation of…
A: Hepatocytes are responsible for regulating blood glucose level. When the blood glucose level…
Q: What is the biochemical rationale for the use of creatine? It would serve as an electron donor to…
A: Creatine, or methyl guanidine-acetic acid, is endogenously formed and is a product of natural…
Q: NEORAL oral solution contains 100 mg/mL of cyclosporine. If a pharmacist prepares 30 mL of an oral…
A: Dilution is a lab procedure by which the concentration of a solute in a solution is lowered by…
Q: Construct a graph of the rate of reaction as a function of PNPA concentration for the…
A: we have to plot graph between trypsin rate and pNPA.
Q: The end product of protein digestion is: a) monosaccharides b) glycerol and fatty acids c)…
A: The objective of these questions is to test the understanding of various biochemical processes,…
Q: A 25-year-old man has a lifelong hemorrhagic diathesis. The PT and bleeding time are normal, but the…
A: Hemorrhagic diathesis is a condition characterized by a tendency to bleed excessively or for an…
Q: Briefly describe the major components of a successful biosensor.
A: A biosensor is an analytical device. It is used for the detection of chemical substances. The…
Q: Give the names of both non-polar amino acids shown in the image Complex I is Comples It is I COO- T…
A: There are four types of biological macromolecules: nucleic acids, proteins, lipids and…
Q: 5. How would you classify B and c? What are they used for? Are A and D diastereomers? Are A and D…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Monosaccharides are simplest carbohydrates:…
Q: 3. Show that the inverse of equation 29-78 in the textbook gives the Lineweaver-Burk Equation. The…
A: The Michaelis-Menten (MM) equation is the general equation used in most enzyme kinetic studies. The…
Q: Complete the sentences describing membrane lipids by moving the names of the lipids to the…
A: Lipids are the only group of macromolecules which is composed of structurally different species on…
Q: Enter the product of this Schiff base formation reaction: OH OH OPO3²- OH where R. represents…
A: Schiff bases are compunds with a double bond between a carbon and a nitrogen atom.
Please don't provide handwriting solution
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Question 33 What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 O 3- GCCTACGGGCATATG -5 O 5- GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG -3 O 3- CGGATGCCCGTATAC -5Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this DNA sequence: TGCAGACT *record your answer with no spaces, dashes, or other charactersQuestion 25 If one DNA segment has the following base composition, 5-CAGTTAGTCA-3', which of the following sequences is complementary? A 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5' 3-TGACTAAСTG-5 D 5-TGACTAACTG-3'
- Quèstion 34 Enzyme that joins the DNA fragments O Recombinant DNA Technology O Restriction enzymes O Ligase O Palindromic sequencesQUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.QUESTION 4 After you get your gene block, you do a restriction enzyme digest and ligation reaction with the plasmid/gene, so you can proceed to bacterial transformation! How does the plasmid get into the bacteria though? O You mix the plasmid in lipids with several other plasmids to make lentiviral vector that'll infect all the other cells. O The plasmid will be transmitted through a pilus to the other bacteria. O You make the bacteria chemically competent using calcium chloride, and then subject the cells to heat shock O Bacteria will naturally take up the plasmid so you don't need to worry about it.
- QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…QUESTION 5 Based on the plasmid shown, what will you have to use to to distinguish and isolate the bacteria that successfully took up the plasmid? O Lactose O Tetracycline O Ampicillin O UV light to identify the glowing colonies O XgalQUESTION 23 Below is a plasmid with restriction sites for BamHI and EcoRI. Several restriction digests were done using these two enzymes either alone or in combination. Which lane shows the fragments produced when the plasmid was incubated with both EcoRI and BamH1? Plasmid Bam HI. Bam HI OI O O 2 Kb O O || ||| IV V 4 Kb 6 Kb PGEN101 (20 Kb) Eco RI Bam HI 8 kb Base pairs 20 Kb 11 Kb 8 Kb 6 Kb 3 Kb I Gel lanes. || III IV V
- Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCGATATAAGTGCACCATGCGAT 5' Start site Short Answer 140Question 32 Enzyme that combines the 2 DNA fragments from different organisms Recombinant DNA Technology Restriction enzymes O Ligase O Palindromic sequencesQUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.