12 Select the statements that describe genomic DNA libraries.DNA fragments are cloned into vectors.✔useful for determining gene functionDNA is synthesized from template mRNA.developed for genome sequencingonly includes DNA from exonsIncorrectnumber of clones for 99% probability:Lx Give Up?460FeedbackIncorrectMail - Briana Sofon - OutGenomic libraries are constructed for genomic sequencing. The library of vectors is transformed into bacteria or yeast. Eachbacterial or yeast cell grows into a colony and represents one unique fragment of DNA.ResumeSuppose you are working with a newly discovered bacteria with a genome of 6370 kbp. If you construct a genomic library madeup of 5.0 kbp fragments, how many clones would you have to screen to get a 99% probability of finding a particular fragment?Attempt 2clones

DNA libraries are catalogs of genetic information. DNA libraries are of different types, the two…

Answered: Select the statements that describe…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
Fig 3.16 EcoRI SacI KpnI |ampR Aval Xmal Smal lacZ BamHI Xbal SalI Accl HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? 3 O 4 O1 2
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation la: Several factors (including agarose gel concentration, time and current) affect migration of DNA fragments through the agarose gel. Briefly explain how each of these factors affects DNA migration. Agarose gel concentration: Time: Voltage: 1b: Do DNA fragments move towards the positive or negative end of the gel box? Explain your answer. 1c: What is the purpose of the Tris-Acetate-EDTA (TAE) buffer that the agarose gel is prepared with and submerged in for running? What would happen if you used water to prepare and run the gel instead of TAE buffer? 1d: If the student is homozygous for the brown allele, how many bands will they see in the lanes for the blue and brown allele samples? (circle one) Brown sample: 0 Blue sample: 1 2 more than two. 1 2 more than two. le: If the student is homozygous for the blue allele, how many bands will they see in the lanes for the blue and brown allele…
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 19 options: LINE & SINE/Alu sequences LINE sequences & IS elements transposons & LINE sequences transposons & retrotransposons SINE & Alu sequences
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS