Q: Are the healthcare concerns, infections, and nosocomial infections discussed for genera…
A: Many studies have demonstrated that nosocomial S. aureus infection, particularly bloodstream…
Q: Discuss what causes the trend of sperm motility in different medium shown in Table 1
A: The above experiment shows how different cryopreservation stages can affect the sperm motility. A…
Q: escribe the aerial modifications of the sten
A:
Q: Q1. Considering how readily RNA folds to form secondary structure, why isn't it used to store…
A: As per Bartleby guidelines experts are allowed to answer only 1 question kindly post the other…
Q: 1.Animals which can be cut in any vertical plane through their central axes (plural of axis) to give…
A: symmetry, in biology, is the repetition of the parts in an animal or plant which is usually defined…
Q: Give different between Microphyllus and Macrophyllus woody plant
A: The main difference between microphylls and macrophylls is that 1. microphylls are leaves having a…
Q: You isolate a glp-1 mutation of C. elegans and discoverthat the DNA region encoding the spatial…
A: The genome is made up of one to several long DNA molecules, and mutations in these molecules can…
Q: Question:- Cells need a way of counting how many divisions they have undergone to keep track of…
A: The majority of replication errors are fixed during replication by DNA polymerase or by…
Q: Which of the following is used in the reaction called saponification? A. Strong Base B. Hydrogen C.…
A: Biomolecules are engaged in a variety of biological and chemical processes in the human body and are…
Q: Consider two maize plants:a. Genotype C/cm ; Ac/Ac+, where cm is an unstableallele caused by a Ds…
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: Figure 1. This image corresponds to question 16. 16a. Name the tissue 16b. What are the thicker pink…
A: Areolar Connective Tissue are the type of tissue which connects the different types of organs in the…
Q: The crown-of-thorns (COT) starfish occurs naturally on reefs throughout the Indo-Pacific region.…
A: Crown of thorns starfish act as an invasive species because of its dense populations, and the…
Q: Question 10 The signs of internal bleeding include all of the following except: a. black,…
A: Signs of internal bleeding are given :-
Q: What type of amnesia do you have when you cannot remember things that happened before a traumatic…
A: Introduction :- The loss of memories, such as facts, information, and experiences, is referred to as…
Q: In Figure 15-3a, what would the kernel phenotype be ifthe strain were homozygous for all dominant…
A: The genetic background, or the sum of all genes affecting the anthocyanin pathway, determines the…
Q: 38- What structures make up the hard palate? 39-What structures make up the hepatic triad? 40-What…
A: In the human body; there are diverse types of structures present; which play very essential role in…
Q: Discuss the pace of evolution by describing punctuated equilibriumand phyletic gradualism.
A: Introduction:- Different tempos of speciation are not described by punctuated equilibrium or…
Q: The entire genome of the yeast Saccharomyces cerevisiaehas been sequenced. This sequencing has led…
A: A mutation is well known that they are been refer change in the sequence of bases in DNA or RNA.…
Q: 20. What type of tissue is in the image? Figure 5. This image corresponds to question 20.
A: There 4 basic tissue types in the body:- Epithelial, connective, muscular, and nervous tissue. The…
Q: What is throat cancer and why is it bad
A: Usually cancer cells that get developed in pharynx are considered under throat cancer. Throat cancer…
Q: Sugars are technically called carbohydrates, referring to the fact that their formulae are only…
A: Glycosidic bond or glycosidic linkage It is a type of covalent bond that joins a carbohydrate…
Q: Give examples, names the three main inflorenscene types of grasses
A: A group or cluster of flowers formed on a stem made of a primary branch or a sophisticated pattern…
Q: In the image above, the elongated dark (heterochromatic) nuclei represent A Satellite cells B…
A: Nuclei A nuclei is a double membranous structure that contains chromosomes of the cell.
Q: Part I: Study the diagrams below, which show carbohydrate molecules. Beside each molecule, write…
A: Maltose is a sugar that is comprised of two glucose units that have been bonded together. It is…
Q: Imagine you are trying to use an organism to remove organic matter in a wastewater treatment plant…
A: There are few important points about organic matter in waste water treatment plant and about…
Q: al Meiosis I Meiosis II e from a male with the genotype Aa for a give
A: Meiosis I - The two gametes produced will have chromosome no reduced to half.They are Aa and Aa…
Q: What bacteria grow on both a MacConkey agar plate and Mannitol Salt agar?
A: Selective media The media is a kind of growth media which only allow the growth of a perticular…
Q: What is the main approaches of genetics?
A: Genetic research has advanced considerably over the last few decades to improve human health. This…
Q: Question attached
A: Molality: The number of moles of solute per kilogram of solvent is defined as molality.Molality is…
Q: Question 19 N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the…
A: Antigen are present on the membrane of red blood cells. The presence of antigen determines the blood…
Q: Before the integration of a transposon, its transposasemakes a staggered cut in the host target DNA.…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: Terma: Wolbachia, L1, L2, L3, L4, aduit, proboscis, fat body, hemocoel, midgut, hemocyte, melanize,…
A: Heartworm disease is a serious ailment that results in intense lung ailment, coronary heart failure,…
Q: Evidence-“Coral reefs surround the planet, providing food and shelter to more than 25% of all marine…
A: Coral reefs are one of the world's most diversified ecosystems. Coral polyps, or reef-building…
Q: How many types of “foreign molecules” (use the proper term where needed) does each cell recognize?…
A: Antigens can be classified according to their source: Antigens from outside the body Exogenous…
Q: Match the following descriptions to the given choices. The first molecule in the biosynthesis of…
A: ANSWER) The first molecule in the biosynthesis of steroids that contains…
Q: A fish swims from a body of cool water into a body of warmwater. As its body temperature rises, its…
A: Fish use their gills to help them breathe. The majority of fish have gills on both sides of their…
Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…
A: Introduction Unsaturated fatty acids have one or more double bonds i.e. they have one or more…
Q: Describe two examples of enzyme involvement in photosynthesis. 2. Explain the role of the cytoplasm…
A: * photosynthesis is a process in which plants use sunlight and water and carbon dioxide to create…
Q: Mention the important characteristics of coelenterate and give examples
A: Animals kingdom is a kingdom which involves eukaryotic organisms basically heterotrophic in nature .…
Q: What are the hindering factors in attaining valuable information about archaea and as well as future…
A:
Q: Compare how histones and micro RNA control gene expression.
A: Gene expression regulation is an important program in the body. There are multiple mechanisms by…
Q: 2. When does a human body elicit an anamnestic response?
A: *Anamnestic response is the Re established creation of antibody for the second time when someone…
Q: State the role of the uterus in the development of the fetus and the placenta.
A: Answer : uterus plays an important role during the pregnancy as it helps in development of the…
Q: locus codes for drought tolerance in desert tortoises. On average during a drought, genotype AA…
A:
Q: N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the A antigen?…
A: A set up three, four or more alleles which have arise in as a result of mutation of the normal gene…
Q: Describe how the following external factors affect tiller production in vegetative grasses. 1.…
A: A tiller is a shoot that arises from the base of a grass plant. The term refers to all shoots that…
Q: One could say that a respiratory pigment with relatively lowO2 affinity is potentially…
A: Answer :- The sigmoid-shaped dissociation curve describes the relationship between…
Q: 38. What types of teeth are in the human body? 39.What are the three primary structures for the…
A:
Q: Members of which phylum are known as "segmented worm" Write about their body symmetry, mode of…
A: The segmented worms belong to the phylum Annelids. Annelids are also known as ringed worms. It is a…
Q: Figure 2. This image corresponds to question 17. 17a. Name the tissue 17b. What are the names of the…
A: 17a. cartilage tissue 17b. Chondrocytes
Step by step
Solved in 2 steps
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.Generation of induced pluripotent stem (iPS)cells was first accomplished using retroviral vectors tocarry the OSKM (Oct4, Sox2, Klf4, and Myc) set of tran-scription regulators into cells. The efficiency of fibroblastreprogramming was typically low (0.01%), in part becauselarge numbers of retroviruses must integrate to bringabout reprogramming and each integration event carrieswith it the risk of inappropriately disrupting or activatinga critical gene. In what other ways, or other forms, do yousuppose you might deliver the OSKM transcription regula-tors so as to avoid these problems?Repressor protein controlling own regulation in Lamda lysogenic cycle, justify with the following presentation.
- Article about RPA-mediated recruitment of Bre1 couples histone H2B ubiquitination to DNA replication and repair. The question, Explain the mechanism of the genotoxic agent invalidating the regulator and pathwayWhich statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.draw the p21 promoter. Your drawing should include (1) the start site, (2) the TATA box and (3) the ERE/AP-1 binding site
- Pls answer ASAP. Sec61 is a protein involved in the formation of the translocon for ER-targeted proteins. What would happen to the proteins targeted to the Golgi Apparatus in a mammalian cell in which the Sec61 is mutated?Cell signaling The maximum secretion rates of proteins are one type of limiting constraint on signal-ing processes since a cell cannot send a signal faster than it can secrete it. These maximum signalingrates can be estimated with maximum rates of transcription and translation. Consequently, proteins withstrong promoters can be synthesized at much higher rates. Immunoglobulins, which are important signal-ing molecules, have very strong promoters. Their maximum secretion rate is on the order of 2000 to 8000antibody molecules/cell/second, which corresponds to approximately 1 pg/cell/hr. Part AWhat would be the maximum signal (in pg/cell/hr) that a cell could send for the following situations: (1)Signal molecule A has a MW = 100,000 daltons and is secreted at a rate of 1000 molecules/cell/second. (2)Signal molecule B has a MW = 50,000 daltons and is secreted at 5000 molecules/cell/second.Part BWhich molecule is secreted at a higher rate? By how much?Part CIf equivalent fluxes of both…An important mechanism for generating diversity in immunoglobulin light chain V-region sequences is based on the fact that the RAG recombinase generates hairpin structures, rather than blunt ends, at the cleavage sites between the recombination signal sequences and the coding sequences. Explain how this mechanism generates diversity at the junctions.
- What would you expect krox20 expression to look like in embryos treated with an RA inhibitor? Why? Strictly no plagiarism.IG-LA ED What pattern of functional protein synthesis of ß-galactosidase and permease, respectively, would you expect from an I*P*OCZ+Y+ lac operon in the absence of lactose? O ++ O -- O +- O+Regulation of Genes and Their products 1. Given the following genotypes, explain how the mutation (identified by a (-) superscript) wil affect E. coll grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of gene products from the lac operon? What will be the implication of the missing gene product, if ever? Will the cell be able to survive in the lactose medium or not? a. I+p+o+z- y+ b. i- p+o+z+y+ c. i+p+o- z+y+ d. i+p- o+z+y+ 2. In terms of the trp operon, differentiate between two normal bacterial cultures, one grown in a medium supplied with tryptophan and the other medium without tryptophan. 3. Experiments show that mutations at gene E lead to non-repressible transcription of trp genes. Why?