Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Row A B C D. OB. B D c. c D. D Select one: OA A Mutated DNA ATG ATG ACT ACT AUG UAC ACU UGA Resulting Amino Acid Methionine Tyrosine Threonine Stop
Q: Neuroactive drugs, such as the antidepressant fluoxetine, function by affecting the metabolism of…
A: Fluoxetine is a selective serotonin reuptake inhibitor (SSRI) antidepressant.
Q: It has been said that undercooked chicken can give you Salmonella food poisoning. Which species…
A: Here, option D) S. enterica is the right answer.
Q: The order of alleles on the chromosome is...
A: During the process of meiosis, when the chromosomes from the mother and father exchange some part of…
Q: Question 24 Extremist prokaryotes are O bacteria and archaca O bacterial O archaeal O archaea and…
A: Depending on the basic composition of their cells, all living things can be divided into one of two…
Q: We transformed E coli cells with a plasmid modified to contain a ‘virulence factor’ which would…
A: To calculate the amount of plasmid required for the transformation reaction, we can use the…
Q: Black coat Brown coat Yellow coat In a particular breed of dog, the following genotypes and their…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Hominids (aka Hominines) evolved first in this habitat: Group of answer choices Deserts…
A: The evolution of hominids, our early ancestors, is a fascinating journey that has been shaped by…
Q: Mutations that occur in one member of a gene pair that arose from genes duplication may create a…
A: The correct options are all of the above.. Mutations that occur in one member of a gene pair that…
Q: 20. Which of the following are molecules of heredity? all of the choices are possible…
A: In genetics, inheritance is a pattern in which the genetic elements such as genes and characters are…
Q: Number list the behaviors that sets us apart from all the other members of the genus_Homo
A: Homo is the genus which belongs to Family Hominidae, Order Primates, Class Mammalia and Phylum…
Q: Syphilis is caused by this bacterium. O S. enterica O V. cholerae O S. dysenteriae O S. typhi O T.…
A: Bacteria are small, unicellular organisms. They are prokaryotic and don't have a nucleus, nuclear…
Q: Which structures shown above are typically haploid? lect one: A. Plant spores and animal zygotes B.…
A: Haploid cells are those cells which contain only one set of chromosomes. These structures are…
Q: What is 'The Aging Human Body' what are the details of human life and sexual reproduction?
A: The aging human body is a natural process that involves a variety of changes that occur in the body…
Q: Which type of disorder is most difficult to correct by gene therapy? an incompletely dominant…
A: Researchers are constantly trying to come up with novel solutions to the problems brought on by…
Q: 1. Write the mRNA strand that would be created based on the DNA strand below. 2. Write the tRNA…
A: Deoxyribonucleic acid or DNA is the molecule that contains the genetic material in living organisms…
Q: A student argues that it makes no sense to be concerned about coliforms in drinking water because…
A: Coliform bacteria are classified as Gram-negative, non-spore-forming Bacilli which can be motile or…
Q: Explain why measuring the amount of oxygen released from a plant would be a good indicator of the…
A: Photosynthesis is the process by which plants produce their own food by combining water and carbon…
Q: Researchers discover two populations of monkey flower (Erythranthe) in Yellowstone National Park.…
A: A genus of flowering plants in the Phrymaceae family is called Erythranthe. It was once categorized…
Q: Match the relationships to the corresponding concepts. Expanding nucleotide repeat Somatic mutation…
A: Mutation refers to a process in genetics and biology where there is a permanent change in the DNA…
Q: Describe the Prokaryotic genome structure and size (1000 words
A: Prokaryotes are the organisms that have simple cellular organisation in the form of absence of…
Q: or s The diagram above illustrates the process of statement) Row А. B. C. D. i translation…
A: Translation is the process by which RNA is used to make proteins.Transcription is the process of…
Q: A part of an mRNA molecule with the following sequence is being read by a ribosome: 5'- CCG-ACG…
A: The production of polypeptide chain (protein) from the mRNA is known as translation that occurs…
Q: Arabidopsis plants that have mutant AtSUC2 alleles accumulate sugar and starch in their mature…
A: A highly specialized vascular tissue called phloem creates a continuous network of connecting…
Q: Differentiation of B cells into Ab-producing plasma cells occurs in the: a) Lymph nodes b) Spleen c)…
A: B cells or B lymphocytes, which are produced from bursae, are important components of the adaptive…
Q: The development of primary and secondary immune responses to an antigen differ significantly. The…
A: The body's defence against infection is provided by the immune system, an intricate system of…
Q: Which type of animal would require the most frequent feeding? Select one: a. An insectivorous…
A: Smaller animals with high surface area-to-volume ratio need to eat more frequently to sustain their…
Q: An aquatic arthropod called a Cyclops has antennae that are either barbed (B) or smooth (b). In the…
A: It is given that allele B (barbed antennae) is dominant over allele b (smooth antennae). Also,…
Q: Select the group(s) in the phylogenetic trees that is/are most closely related to frogs. SELECT ALL…
A: Phylogenetic tree is defined as a diagrammatic representation of evolutionary relationships among…
Q: Which two plants with psychoactive properties were known to be used for medicinal purposes in…
A: Ancient Egypt, with its rich and mystical history, was no stranger to the use of plants for…
Q: Zoology 05: Taxonomy Lab/ Tree Building Exercise Group Members: Section 1. Name the organisms (be…
A: In order to explain the relatedness among different species different characters are chosen and on…
Q: This fungus prefers damp environments like those you may find in a basement. O A. flavus O A. niger…
A: Aspergillus flavus is another species of filamentous fungus from the Aspergillus genus. It is…
Q: Which of the following diets would be best to help reduce the chance of hip dysplasia and…
A: Bone dysplasia and osteochondrosis both are related to improper bone development. So if there is…
Q: True or False: A person with type O blood will have a Type II hypersensitivity reaction against…
A: Hypersensitivity is a condition in which the immune system reacts excessively to a foreign substance…
Q: Use the photo below to draw a sketch WITH the gametangia and zygosphere labeled.
A: To answer the question of drawing a sketch with labeled gametangia and zygospore, we need to…
Q: Which of the following describe what enzymes such as Chymotrysin accomplish to allow products to…
A: Answer : the enzymes such as Chymotrysin accomplish to allow products to form and be released by the…
Q: Classify each statement as true or false. A mating between SS and Ss individuals will result in all…
A: Dominant allele is able to express itself even in the presence of its recessive allele. Its effect…
Q: This fungus is a common bread mold. O C. albicans O A. niger O A. flavus O P. notatum O R.…
A: Candida albicans is a type of yeast and one of the most common fungal species found in the human…
Q: #1 Structure "B" in the diagram above is... Select one: COA a sugar group (deoxyricose) OB. a…
A: A polymer made of two chains of polynucleotide wrapped around one another to create a double helix…
Q: During aerobic respiration in eukaryotes, which substrate molecules provide the oxygen atoms that…
A: The most effective method of obtaining energy from organic compounds, notably glucose, to form…
Q: An epidemiological study was performed and the relative risk linking high cholesterol to heart…
A: Here, option A) Neutral is the correct answer.
Q: Please read the scenario below and answer the question (in bold) that follows: In humans, the…
A: To determine the percentage of their children who would be able to roll their tongues, let's analyze…
Q: Pls help ASAP. Use the info to ans the q.
A: Based on the information provided, the correct option would be::- the lac operator (lacO).The lac…
Q: Which step of the double Holliday junction pathway is directly responsible for ensuring that no…
A: For cells to survive, DNA double-strand breaks must be correctly repaired. The RecBCD mechanism of…
Q: 9. Which of the following statements about gene regulation is not true? ORNA interference is the…
A: The processes that regulate how genes are expressed in cells are referred to as gene regulation. It…
Q: Which of the following is NOT a physiological role of phosphorus? Select one: a. Required…
A: Phosphorus is an essential element that plays a fundamental role in various physiological processes…
Q: Put the steps of the chymotrypsin's enzymatic reaction in order of events from #1-10. -Tetrahedral…
A: Chymotrypsin is a serine protease enzyme that catalyzes the hydrolysis of specific peptide bonds in…
Q: nter your answers in the spaces provided.
A: Muscle fibres are specialised cells that make up the muscular system. its ability to contract is its…
Q: Which of the following would be considered a quantitative (continuously varying) trait? Choose all…
A: A quantitative attribute, like height, is one that can be quantified statistically. The genetic…
Q: Select all that apply: Which of the cells kill in the same manner? ONK cells Regulartory T cells O…
A: NK cells are a type of lymphocyte, which is a white blood cell involved in the immune response. NK…
Q: Evaluate the following staining procedures and identifying characteristics and match them to the…
A: Microbiology: The study of tiny creatures' biology includes viruses, bacteria, algae, fungus, slime…
Step by step
Solved in 3 steps
- Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.Iv been marked with 3 wrong answers for this problem. please help me identify my mistake. I understand mrna initiates but when in order of trna and rrna im a bit confused...Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТ Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: ATG CGC TCC CAT CTT AAC CAA AGA GGT TGG CTA TTT T Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- missense nonsense antisense O frame-shift silent
- a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of impact will this mutation have on the functionality of the protein? Second Letter UAU Tyr UAC UUU UCU UGU UGC Phe Cys C UUC UUA UUG UCC UCA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G Leu UCG CGU CAU His CCU C CCA G CUU CUC CAC CGC Leu CUA Arg Pro CGA CGG CAA Gin CUG CAG AUU AUC lle AUA AUG Met ACG ACU ACC ACA AAU Asn AAC The AAA AGU AGC Ser AGA AAG Lya AGG Arg GCU GCC GUU GAU GAC GAA GAG GGU GGC Gly Asp GUC Val GUA Ala GCA GCG GGA Glu GGG GUG ACC T C A G. G. 6. G G A C T. T. G. Original DNA strand G T A G. G. T. G. G. GA CT T. G. Mutated DNA strand First letter Third letterComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino AcidIf my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What would the final protein product be? (only use the capitalized letters).
- Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer. ACUGAAAUGACCAGAUUUAUGGCCUGAAUGACCSickle cell hemoglobin DNA CA CG TAGACTGAGGACA C Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence ValoHis.lku thro proo Gily 4. What type of mutation is this? Please explain why.Describe missense and nonsense mutations and how they are different from frameshift mutations. Be comprehensive and tailor your answer to explain the impact of these mutations on the protein expressed
- Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.Туре of mutation: Effect: Original Altered protein/ amino acid sequence sequence DNA nucleotide MRNA AUUCGAGUA AUUCGGGUA amino acid MRNA ACGGAACCG ACGGUACCG amino acid MRNA GCUAGAAGU GCUUGAAGU amino acid MRNA GGCGCUACAUCA GGCAGCUACAUC A amino acid MRNA GGCGCUACAUCA GGGCUACAUCA amino acidIf a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid has very similar properties (e.g. non-polar amino acid substituted for another non-polar amino acid), then it is likely this mutation will have no effect on the function of the protein and will be termed a neutral mutation. O True False