Which of the following joints can be considered as never moves type? A) Fibrous joints B) Synostosis C) Syndesmosis D) Diarthrosis E) Cartilaginous joints
Q: Draw a picture of a cell with 6 chromosomes in Metaphase of Mitosis, Metaphase I of Meiosis, and…
A: Metaphase is the second stage of cell division in which the chromosomes arrange themselves in an…
Q: Which of the following is NOT a description of the Arthropods? Exhibits true segmentation in the…
A: Introduction Arthropods:- These are invertebrate animals having an exoskeleton, a segmented body,…
Q: The urinalysis came back for your patient, it was amber, non-cloudy, no WBC, no RBC, there was…
A: When the kidneys stop functioning properly, it's known as acute kidney injury (AKI).
Q: What is your stand regarding recombinant DNA technology? Give valid reasons why you think the way…
A: Recombinant DNA is the method of joining two or more DNA molecules to create a hybrid.
Q: How does systematic methods and evolution helps in understanding the probable origin of SARS-CoV-2?…
A: The severe acute respiratory syndrome–associated coronavirus is a virus family that includes several…
Q: region
A: Amgydala is thought to be the central part of the nervous system which is required for the…
Q: 5) Describe the three areas of focus for reducing cholesterol in the body.
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: Which is INCORRECT about sea urchins? A. Spines are movable B. Secondary spine is shorter a d solid…
A: Sea Urchins are echinoderms having a spiny outer structure. They move with the help of tube feet…
Q: 1. Which of these methods will allow cell counting and segregation? a. Flow Cytometry b. Western…
A: Introduction :- Bio-physical techniques or methods are combination of biological and physical…
Q: Which of the following lipoproteins is the precursor for LDL? O Chylomicrons HDL LDL VLDL
A: Chylomicrons are produced in intestinal cells. It is a fat droplet present in blood or lymph after…
Q: In an evolutionary perspective, what would happen to the population of angry clip birds after 1000…
A: Variation is vital for species survival because it allows the organism to overcome adversity.…
Q: Lipids forms membranes due to the effect of hydrophobicity that promotes self-association. O True…
A: Introduction Lipid:- A lipid is any of various organic compounds that are insoluble in water but are…
Q: Cross #1: P: Homozygous scarlet-eyed males F₁ Fs Homozygous brown-eyed females X 1072 Wild-type…
A: Answer :- a) Phenotypic ratio of F2 generation is 9 :3: 3: 1, for wild type eye, scarled eye,brown…
Q: hat kind of cells are suitable for flow cytometric analysis and why?
A: FCM is an approach for identifying and quantifying the physical and chemical properties of a cell…
Q: 1. It is the creation of an offspring by fusion of haploid gametes, male sperm and female eggs, to…
A: Introduction Reproduction:- It is the process of producing new individuals of the same kind, an…
Q: 35) how epinephrine can have a depolarizing effect on one tissue and a hyperpolarizing effect on…
A: Hormones are chemical substances produced by our body's endocrine system, which releases the…
Q: Question 4 "The following describe lipoprotein organization, classification & function, EXCEPT: "…
A: Answer is.. "Lipid content is less than protein thus, the higher the % TAG the less dense the…
Q: Consider the following graph of an action potential: 60- 30- membrane potential (mV) O -30- -60 line…
A: Action potential refers to the sudden rise and fall of membrane potential across a cellular membrane…
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: Question 10 What kind of membrane protein penetrates into the hydrophobic part of the lipid bilayer?…
A: Fluid mosaic model of plasma membrane was given by Singer and Nicolsan. It explains the lipid…
Q: When a very strong stimulus initiates an action potential, the response is: I. a longer-duration…
A: Anything that causes an animal or a section of an animal to respond in a way is referred to as a…
Q: Number the seven major taxonomic groups in order from the one containing the largest number of types…
A: In this question we have to describe about some taxonomic rules. As per our guidelines we are not…
Q: In a typical insect leg, what part may be composed of 2 to 5 segments? a. Femur b. Trochanter c.…
A: In insects, the legs are jointed and usually have six parts - coxa, trochanter, femur, tibia, tarsus…
Q: Give five (5) other examples of samples that are best prepared using Smear Preparation Technique…
A: Smear preparations involve spreading cells from a culture in a thin film over a small region of a…
Q: what if a mutation resulted in the enzyme DNA polymerase III being non-functional? How would that…
A: The mutation is defined as the change in sequence of nucleotides in a gene. The mutation can either…
Q: Shown below are single-stranded DNA probe and target sequences. Where on the target sequence will…
A: In cells, DNA (Deoxyribonucleic acid) is the nucleic acid that functions as the original blueprint…
Q: longer functional. Ependymal cells Oligodendrocytes Microglial cells Astrocytos system which remove…
A: introduction The nervous system is a network of neurons whose primary function is to create, modify,…
Q: on in sis tion Group 2 Group 3 Group f Group 2 Group 2 Grup 3 One Group 2
A: The picture is showing the relationship between photosynthesis and respiration reactions. These…
Q: What are the advantages and disadvantages of self and cross pollination?
A: To ensure their viability and generation of species, the plants go through various modes of…
Q: 1. Differentiate the platelet aggregometry from platelet closure time as to: (2 sentence each to…
A: We are supposed to answer one question according to our guidelines, please repost other questions…
Q: In te Water Level Control Experiment, what type of sensor was used and why? Kindly explain…
A: Experiment with water level control: the program replicates changes in water level in a tank. It…
Q: Describe briefly what happens in each step.
A: Step 1) Denaturation:- In this step there is a proper unfolding of the genomic DNA and subsequent…
Q: How are the structures of the pistil and stamen adapted for successful fertilization?
A: Flowers are angiosperm organs that specialize in sexual reproduction. Flowers are specialized organs…
Q: Gymnosperms have ___________ but no fruits or flowers.
A: Two terms are very common in the plant kingdom - Gymnosperms and Angiosperms. Angiosperms are the…
Q: b) Phenotypes of progeny from test cross: WT = 12, Circle nonparental (NP) classes above. Genotype…
A: Test cross This cross is done to identify the genotype of the individual. In this cross, the…
Q: What words below characterizes the amino acids that are found in an alpha-helical segment that spans…
A: The plasma membrane is present in the cell. It is responsible for covering the cell. It provides the…
Q: What happened to the angry clipbird population in the East over the three seasons? Explain why you…
A: Natural selection acts on genetic variation within a population to produce evolution. Natural…
Q: Which of the following does NOT contribute to muscle fatigue? A. K+ accumulation B. ADP and…
A: Introduction Muscle fatigue is a condition in which muscles loses the ability to perform overtime.…
Q: . ________ are the flower parts found above (inside) the corolla. Each is composed of two…
A: Flowering plants or angiosperms are group of plants that bear flowers and produce seeds. A flower…
Q: 5. Enumerate preventive measures for these infections. COMMON ETIOLOGIC MODES OF DIAGNOSTIC…
A: The table is filled providing sufficient information as follows:
Q: How would we explain using examples the non-Mendelian inheritance patterns such as incomplete…
A: Non-Mendelian inheritance It is defined as the inheritance pattern in which the traits are not…
Q: How is the topic about Threats (Biodiversity & Sustainability, Climate Change and Pollution) and…
A: The "Earth" is a massive ecosystem. An "ecosystem" is a group of plants, animals, and other living…
Q: Located below is a list of examples of hypotheses. You must critique each hypothesis and assess if…
A: A hypothesis is an assumption that is proposed for so that it can be tested to see if it might be…
Q: please answer question b also. b. For the Covid-19 pandemic), give any issues, benefits, or…
A: Within the twentieth century, the world suffered pandemics. The pandemics, as horrifying and lethal…
Q: 5. Which nervous system holds the brain and spinal cord? Central Nervous System b. Peripheral…
A: Introduction Brain:- The organ inside the head that controls all body functions of a human being and…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Ligand-activated receptors should be ________ before they can bind DNA and activate transcription.…
A: The ligand- receptors are the proteinaceous substances which allows the binding of the ligands to…
Q: "apoA, apo(a), apoB, apoC and apoE" "apoA, apoB, apoC, apo E, and apol" O "apoB, apoC, apoD, apoE…
A: apolipoproteins are the proteins that bind lipids. These lipids could be in the form of cholesterol…
Q: Please answer all question below. These are all the questions left. Question 7: Select one answer.…
A: Aldosterone is a hormone that is released by the adrenal gland in response to low blood pressure and…
Q: See question 3. Is the shaded recessive or dominant and tell me exactly were to circle please.
A: The pedigree analysis helps us to identify the mode of inheritance of a particular disease and also…
Step by step
Solved in 2 steps
- Which of the following joints can be considered as never moves type? A) Fibrous joints B) Synostosis C) Syndesmosis D) Diarthrosis E) Cartilaginous joints Explain all optionsWhat does a syndesmosis joint have in common with a symphysis joint? a) Both are fibrous joints. b) Both are cartilaginous joints. c) Both are synarthrotic joints. d)Both are amphiarthrotic joints.complete the ff Classification of Fibrous and Cartilaginous Joints Category Type Structure Degree of Movement 1) Suture 2) 3) 4) Symphysis 5) 6) Cartilaginous 7) 8) No movement Fibrous 9) 10) Little movement 11) 12) Periodontal ligaments anchor teeth to bones 13)
- Which of the following are joint motions (choose all that apply)? A) FlexionB) CircumductionC) CombinationD) AbductionE) ExtensionF) AdductionG) PronationH) SupinationI) RotationWhich of the following statements defines synchondroses? A) Amphiarthrotic joints designed for strength and flexibility B) Cartilaginous joints where hyaline cartilage unites the ends of bones C) Interphalangeal joints D) Joints that permit angular movements Please give a brief explanation of each. thanksAn example of an interosseous fibrous joint is____ A) Clavicle and scapula at the distal ends. B) Between the vertebrae. C) Between the humerus and the glenoid cavity D) The radius and the ulna along its length. Please give a quick explanation for each correct & incorrect. Thanks
- A) Identify the type of synovial joint seen here which allows only the movement of flexion and extension. [type means ball and socket, hinge, pivot etc] B)Give one example of this type of joint.Allows movement of 180 degrees, found in knees and elbows A) Fixed JointB) Hinge JointC) Ball and Socket JointD) Pivot Joint3) Which is NOT a typical cause of failure of total joint replacement?a) Infection b) Aseptic (non-infection) loosening c) Fracture of acetabular cup d) Dislocation
- a) State any FOUR (4) types of synovial joint b) Draw and label typical synovial joint.Allows full 360 degree rotation, found in shoulder: A) Fixed JointB) Hinge JointC) Pivot JointD) Ball and Socket JointWhich of the following properties would limit the range of motion of a joint? a.) a muscle that crosses two joints b.) muscle fibers aligned in series c.) synovial fluid d.) a ligament that aligns with an axis