Which of the following are characteristics that distinguish cancer cells from normal cells? Check All That Apply Cancer cells lack differentiation. Cancer cells have normal nuclei. Cancer cells have an unlimited potential to replicate. Cancer cells form tumors.
Q: Compare and contrast the processes of bacterial replication, bacterial transcription, and bacterial…
A: An explanation of the movement of genetic information within a biological system is the core tenet…
Q: Using Koch's postulates, explain the steps to identify the causative agent of COVID.
A: In the question it is asked to explain the steps to identify the causative agent of COVID, using…
Q: What best explains the mechanism of old (and wicked dangerous) diet pills that acted as an…
A: Diet pills mainly act on metabolism and respiration to reduce the amount of energy and calories so…
Q: Explain why each of the following questions are best answered by an observational study or an…
A: The collection, analysis, and interpretation of data are crucial parts of statistics. The data can…
Q: Consider the following reaction: succinate +NAD is catalyzed into fumarate + NADH In this reaction,…
A: Several biochemical pathways are involved on maintaining proper physiological balance in the body.…
Q: CD4 cells are cells and CD8 cells are cells A killer, suppressor B helper, cytotoxic C cytotoxic,…
A: Introduction: Our immune system's lymphocytes are a subset of white blood cells. There are two of…
Q: Ch. 6: Hypocalcemia is due to an imbalance of: a) parathyroid hormone Ob) growth hormone O c)…
A: When your blood calcium levels are too low, you have hypocalcemia, a disorder that is treatable.…
Q: When can we say that HIV has progressed to the stage of AIDS? List several signs and explain why…
A: HIV or the Humans Immunodeficiency Virus is a virus that affects the immune system of individuals…
Q: apply the knowledge of the structure and function of the eye and the ear to understand the sensory…
A: The specialised organs known as sensory organs, which are made up of sensory neurons, enable us to…
Q: . Explain the processes involved in providing energy during long-term starvation. . Describe how the…
A: Starvation is process which happens if someone don't eat for some days or weeks. And the body…
Q: The human phenotype is regulated by epigenetic control of gene expression. Discuss the three main…
A: Control of gene expression is the process by which cells regulate the production of proteins and…
Q: What pathway does sound follow through the ear? O pinna; ossicles; oval window; tympanic membrane;…
A: Ear is the sensory organ which conducts sound waves from external environment into the inner ear and…
Q: Plant B grows in unstable soil, it also needs to grow rather tall and grow quickly. This results in…
A: Roots are the most important part of a plant it grow under the ground and take water and food from…
Q: Keratin is a type of found in the cytosol, which means its hydrophobic amino acids are Select one:…
A: Keratin is a type of protein that is also known as scleroprotein. This protein is present in hairs.…
Q: oxidized
A: e .tertiary ,oxidized The formation of disulfide bridges by oxidation of the sulfydryl groups on…
Q: 9) Which of the following is not a chemical buffer system? A) bicarbonate B) phosphate C) protein D)…
A: Introduction: The buffer mechanisms in the human body are incredibly effective, and they operate at…
Q: Apart from lactate oxidation within the skeletal muscle, what is the name of the other system…
A: Skeletal muscle is one of the significant muscle tissues present in the human body. Each skeletal…
Q: The diploid number of chromosomes in a cell of a domestic cat is 38. The table below shows the…
A: The interphase, a non-diverging phase, is composed of the G1, S1, and G2 phases in that order. While…
Q: A proteinase found in the lysosome functions by ____. Select one: a. making proteins b. assisting…
A: Lysosomal proteases or proteinase are hydrolytic enzymes that belong to the aspartic, cysteine, or…
Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…
A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…
Q: ATP provides cells with energy by _________ bonds between ______________. Select one: a. forming,…
A: ATP (Adenosine triphosphate) is a significant molecule tracked down in every single living organisms…
Q: describe the steps of a lytic infection typical to a dna virus like herpes simplex virus. in simple…
A: A virus is an obligate parasite with DNA or RNA as genetic material. The genetic material can be…
Q: Which of the following is a sequence at which a restriction enzyme would cut? A) 5'AAGCAA3' B)…
A: "Restriction enzymes" are enzymatic proteins that bacteria generate in order to protect themselves…
Q: certain cells in the pancreas of animals produce and secrete insulin. Which of the following…
A: Insulin is a peptide hormone which is made in the beta cells of Islets of Langerhans of pancreas. It…
Q: Jyan is 4 months pregnant and requires an IV infusion of magnesium sulfate heptahydrate at a rate of…
A: Magnisium Sulphate: Magnesium sulphate, also known as magnesium sulphate (in English-speaking…
Q: Explain the mechanisms for which the leaf water potential would be more negative at midday than at…
A: Water potential is defined as the potential energy of water in a system compared to pure water, when…
Q: resting state of the protein, the Lys 216 Schiff base has pKa = 9.5 and Asp 85 has pKa = 3.5. When…
A: Lysine is an amino acid with a positively charged R group. Aspartate is the amino acid with a…
Q: What is the relationship between the structure and function of proteins and how are they are…
A: Proteins are made up of a very long chain of many amino acids. Even with a limited no. of amino acid…
Q: What happens to the immune system during the acute, chronic (asymptomatic) and final phases of HIV…
A: Human Immunodeficiency Virus also known as HIV is a virus that attacks and weakens natural defensive…
Q: If you map two different organims daily movements, and see these types of patterns, answer the…
A: Navigation is a way of finding the direction of a particular path by sensing environmental…
Q: We now have at least three SARS-CoV-2/COVID-19 vaccines approved by the FDA for use in the United…
A: Severe acute respiratory syndrome corona virus 2 is the causative agent of covid -19. It cause…
Q: At the synaptic terminal of a motor neuron, the first thing to happen that leads to synaptic…
A: Synaptic transmission, the mechanism by which this information is transmitted, consists of four…
Q: Describe what a occurs on the slide when antibodies bind to its target antigens.
A: Antibodies are the globulins involved in adaptive immune responses. They are produced by the plasma…
Q: Ch. 7: Observing Potter facies in a newborn could be a sign of: a) Wilms tumor b) polycystic kidney…
A: Introduction: As a result of oligohydramnios while in the uterus, babies can have an unusual…
Q: Active transport of a substanceacross a membrane requires A A gradient B the expenditure of ATP…
A: Introduction Movements of ions and molecules in and across the cell membrane are regulated by a set…
Q: Match the leukocyte with its description. Each term may be used more than once. Defense against…
A: Immune system composed of special cells, tissues and organs. It provides defense mechanism against…
Q: evaluate the relationship between the structure and function of DNA and RNA and how they encode for…
A: Both DNA and RNA both are nucleic acids. The difference arises in their sugars, RNA contains a…
Q: BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal…
A: Biotechnology is a field of science that applies biological processes, living organisms or their…
Q: The hemoglobin protein has quaternary structure. This means that hemoglobin Selected answer will be…
A: Hemoglobin is the oligomeric protein,which contains heme as prosthetic group. Hemoglobin is…
Q: Explain how tropisms and hormones work to help plants survive changes in their environment
A: Plants are members of the kingdom Plantae. They are multicellular eukaryotes, capable of carrying…
Q: PLACE THE FOLLOWING IN THE CORRECT ORDER FROM THE TESTIS place you cursor on the dots to toggle the…
A: Introduction: Sperm is a male germ cell or male reproductive cell that is created by males in the…
Q: When a protein becomes phosphorylated, it _________ a phosphate group. This reaction is mediated by…
A: Some of the energy is utilized to generate ATP from ADP and Pi, but ATP is required immediately for…
Q: Your kidneys are responsible for regulating water levels in the body. Given what yo know about…
A: Kidneys are organs responsible for the removal of waste and toxins. The excess water from the…
Q: A chloroplastic protein is encoded by a gene in the nucleus. Which of the following orders correctly…
A: Proteins are biomolecules made up of monomer units "amino acids" adjoined by "peptide linkages".…
Q: how might an RNA based genome result in an increased infection rate. in simple terms please
A: Because of their unusually quick production durations and rapid evolutionary rates, RNA viruses are…
Q: Which of the following is not an organelle? Select one: a. nucleus Ob. ribosome O c. chloroplast Od.…
A: The cell is the structural and functional unit of life.
Q: A22. Which ONE of the following statements regarding biological molecules is CORRECT? (A) The…
A: Carbohydrates are made up of carbon, oxygen and hydrogen atoms. These are essential nutrients which…
Q: question 40 lf a cell is increased to 1000 cells, how many generations in this process? A 100. B…
A: The cell division process causes "significant alterations in both plant and animal cells." For…
Q: Certain types of pathogens are unable to infect humans due to ________. A) a reduction in human T…
A: Pathogens are living organisms that cause diseases. Different pathogens cause infections in…
Q: 23. Explain the relationship between DNA, genes, alleles, and traits. Alleles are also genetic…
A: 23. Deoxyribonucleic acid, or DNA, is a biological macromolecule that carries hereditary information…
Step by step
Solved in 3 steps
- Outline the steps that lead to a cell becoming cancerous.In your own words, explain how cancer cells differ from normal cells in regard to the following: Molecular controls of the cell cycle (include Cdk and Cdk/cyclin complexes, p53 gene/protein, Rb gene/protein in response)45:59 Which of the following are characteristics that distinguish cancer cells from normal cells? Check All That Apply Cancer cells lack differentiation. Cancer cells have normal nuclei. Cancer cells have an unlimited potential to replicate.
- Cells can become cancerous for many reasons. Regardless of how they become cancerous, the same general pattern is followed. Put the steps of cancer development in order from first to last. 1. A cell begins to grow and divide uncontrollably.2. The cell metastasizes and moves through the bloodstream, spreading throughout the body.3. Part of the tumor breaks off and is now malignant.4. The benign tumor is confined to one place.5. A small mass forms, called a tumor.ivision & Differentiation 6. Which of the following statements best explains why cancer is so difficult to cure? OA. Each cancer cell has the ability to control its own growth. OB. Each type of cancer is caused by one gene that continuously mutates. Oc. There are many different types of cancer, each caused by different factors. OD. Every type of cancer is different, but they use the same treatments. Reset SubmitRegarding the mechanisms of cancer, which of the following statements is NOT correct? Ovarian cancer is always the result of hypomethylation of tumor suppression genes Unlike normal human cells that can divide between 50-70 times, tumor cells can divide indefinitely Sirtuins are enzymes linked with longevity that increase in activity in response to resveratrol supplementation Many tumors are able to grow their own blood supply by forming new branches from nearby blood vessels
- Which of the following describes the most likely property of cancer cells, other than un- controllable division? A inability of chromosomes to align during the metaphase B с D alteration of the cell cycle sequence inability to undergo apoptosis inability to form spindle fibersIn your own words, explain metastasis and why this process is important in the prognosis of a patient, and is this an easy and efficient process for cancer cells, why or why not?Write an 800-word essay on debunking this myth about cancer from "Myth Buster by Ted Koren 2012 Issue 5”: MYTH: The cancerous tumor is trying to kill us. FACT: New research reveals that the tumor has a purpose. Andreas Moritz, in Cancer is NOT a disease – It’s a survival mechanism, explains that cancer is a response to internal toxicity. Cancer is how the body tries to keep us alive when we are in danger of imminent death from poison; cancer cells feed off our toxic buildup. Only by addressing the cause of the tumor can we have a real cure. The tumor is so important to the body that it is supplied with special blood vessels. Why would the body try to destroy itself? It makes more sense that the tumor is serving a purpose.
- What is happening in all cancer? What process is this disrupting?Which of the following is not a characteristic of cancer cells? an increase in density dependent inhibition an increase in telomere length a decrease in DNA repair a decrease in cell adhesion molecules an increase in chromosome abnormalitiesWhich of the following is the best description of cancer cells growing larger than normal unregulated cell growth rapid cell growth controlled cel growth Ne
