What type of mutation is shown below:CGG GGG GAG TCT TTT TAT GCA GCTchanges to:CGG GGG GAG CTT TTTATG CAG CTA frame shift mutatuion which resulted from a deletion.O Point mutation in which one nucleotide was changed.O Point mutation in which a length of nucleotides were changed.O A frame shift mutatuion which resulted from an insertion.

Name: What type of mutation is shown below:CGG GGG GAG TCT TTT TAT GCA GCTc
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: What type of mutation is shown below:CGG GGG GAG TCT TTT TAT GCA GCTchanges to:CGG GGG GAG CTT TTTATG CAG CTA frame shift mutatuion which resulted from a deletion.O Point mutation in which one nucleotide was changed.O Point mutation in which a lengt

Structural chromosomal mutations refer to the changes in structure of a chromosome due to insertion,…

Answered: What type of mutation is shown below:

Science

Biology

What type of mutation is shown below:

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’
Identify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’
In Sickle Cell Disease, the 6th amino acid after the START codon is different than it is in wildtype hemoglobin. An alignment of HbA DNA (wt) against HbS (sickle allele) is shown below. Arcel is asked to characterize the DNA mutation according to its nucleotide and position. r + 2 HbA: ATG HbS: GTG CAC CTG ACT CCT GAG CAC CAC CTG ACT ACT CCT GTG Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. ATG GTG The disease is caused by A20 - T20. The disease is caused by T20 - A20. The disease is caused by GAG20 - GTG20. The disease is caused by GTG21 - GAG21 ☐
The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)
For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.
5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation
For the given mutation below,please write down the reverse mutation and any intragenic suppressor mutations for that mutation. Use the codon table for amino acids as reference. In this case, mutation means single letter change. Mutation: AGA -> AGC Arg codons: CGU, CGC, CGA, CGG,AGA,ACG Ser codons: UCU, UCC, UCA, UCG, AGU, AGC Character limit is 10 characters. Write down Reverse mutation sequence first and then intragenic suppressor mutation sequence. Write down the mutated sequence not the mutation.
Fill in the blanks (NO PARAGRAPHS ONLY SHORT ANSWERS) Normal DNA: TGC GTG CTT AAG CGG TGT ACA CGT TGC mRNA: Animo Acid: 1st Mutation TGC GTG CTT AAG CGA TGT ACA CGT TGC mRNA: Animo Acid: Do you think it will affect the protein’s function? Why? 2nd Mutation TGC GTG CTT AAG CGG TGT GCA CGT TGC mRNA: Animo Acid: What kind of mutation is this? Do you think it will affect the protein’s function? Why?
EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.
Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.