Q: 5. a) Briefly explain three advantages that CRISPR has over earlier methods of genetic manipulation…
A: Introduction:- Genome editing is an extremely strong tool that can help you answer a wide range of…
Q: 4. What is a suggestion you have for combating (or responding) to antibiotic resistance?
A: Antibiotic resistance is an acquired resistance pathogens get when they are treated with antibiotic…
Q: Think about the structure and transmission of F factors and discusshow you think F factors may have…
A: F factors are the F plasmid which are found in gram-negative bacteria and accounts for fertility.…
Q: Explain how the overuse of antibiotics promotes resistance in a population of bacteria.
A: Introduction : Microbes that have developed resistance to the majority of antibiotics and antiviral…
Q: 1. What are ethical issues related with GMOS? Do you think human cloning should be allowed or should…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: 1. What is xenotransplantation?
A: Ethical issues concerning the xenotransplantation include the animal rights, allocation of…
Q: 3. Describe the process of genetic engineering and how scientists manipulate genes:
A: genetic engineering is the process of manipulating genome to develop useful products or…
Q: 1. How gene therapy or cell therapy can help cure diseases?
A: Deoxyribose Nucleic Acid is the form in which genetic information is stored in the cell (DNA). This…
Q: Draw a diagram depicting the 4 steps of base excision repair, and give a short description of what…
A: Base excision repair is a cellular mechanism that is studied in the fields of biochemistry and…
Q: 3) After initiation of antibiotic treatment, the symptoms are resolved in two days and the patient…
A: Polypropylene mesh is a medical mesh made of synthetic materials that are used to treat hernias and…
Q: Should we purchase genetically modified foods for us and our families to consume? Explain.
A: Note: since you have asked multiple questions as per our honor code, we are answering the first one…
Q: 24. Versions of the gene that do not confer an advantage (or confer a disadvantage) should become…
A: The theory of Natural selection is given by Darwin. It states the fittest individuals of a…
Q: One beneficial mutation is using point mutation in improving food crops, resulting in variation and…
A: Answer
Q: ) What are the techniques to verify the extracted genome?
A: Genome extraction is a process by which genitic material is extracted from buccal swab, urine, hair…
Q: reverse transcriptase is a nonviral genetic element that facilitate the movement of a transposon…
A: Transposons are the genetic elements that can jump from one location to another location within the…
Q: Identify one specific example of how this process has been used 10. Using the example provided in…
A: Transgenic organisms are created by manipulating genes in the the plant of the animal species. Thud…
Q: 9) Describe the steps required to use sequencing DNA to identify your gene of interest after…
A: DNA sequencing is the process of finding the sequence of the nucleotides on a particular short…
Q: 19. Which of the following statement about vectors are true? a. Vectors can be linear or circular b.…
A: The term vector refers to the DNA molecules that act as transporting vehicle which carries foreign…
Q: How do sialic acid conformations explain the difference between influenza strains that infect humans…
A: An influenza pandemic is a worldwide outbreak produced by a novel influenza virus against which…
Q: Present an overview of the main aspects of the flow of geneticinformation in cells.
A: Genes are the basic structural and functional unit of inheritance. The genetic material in most of…
Q: 4. What in your opinion can the biomedical engineer do to help in the cure of COVID-19?
A: Biomedical engineering is the term used for the combination of biology and engineering or applying…
Q: 1. Do you think the Food and Drug Administration should or should not approve gene therapy…
A: we are answering question 1 only pls repost for rest of question.
Q: genetically modified organism
A: Genetically modified organism or GMO: These are the organisms with superior characters made with…
Q: 1. A vaccine is a biological preparation that provides active acquired immunity to a particular…
A: The phenomenon of vaccination that causes immunization of an individual against certain diseases is…
Q: Explain how therapeutic genes may be delivered topatients
A: Human gene therapy is a successful technique that uses genes to treat and to prevent diseases. In…
Q: Compare and contrast preimplantation genetic diagnosis and genetic testing.
A: Pre-implantation genetic diagnosis (PGD) is commonly described as the examination of embryos or…
Q: In what particularities can u find the presence of Gene Therapy?
A: Gene therapy is the technique of making manipulation in one's gene to treat or cure a disease It…
Q: What is the map distance between the two rapid lysis mutations re and rf given the data below? 2…
A: Hint: Always less numbered progeny becomes recombinants. In the question given that, re- rf- X r+…
Q: 1. Compare the three mechanisms of gene transferin bacteria: transformation, conjugation,…
A: Genetic engineering permits the genetic material (DNA) to be transferred between organisms moreover…
Q: A. What is random mutagenesis? B. How many people a year die due to insecticide misuse and exposure?
A: Selective breeding practises having existed for crops ever since man started cultivation. So there…
Q: State the principle underlying the latex agglutination (LA) and gelatin particle agglutination test…
A: When the specific antibodies (agglutinins) bind to surface antigens of bacteria/virus or any…
Q: What are the implications of resistance gene transfer for the future practice of medicine?
A: Bacteria multiply quickly and have a variety of methods for exchanging DNA. This is how they are…
Q: How are scientists able to realize their objectives in genetic engineerin
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Explain the concept of selective toxicity. How does it apply to the development of antibiotics?
A: Medicines known as antibiotics are used to treat bacterial infections in both humans and animals.…
Q: Bacteriophage are very specific in the types of cells they can infect. Some see this as a possible…
A: A bacteriophage also known informally as a phage is a virus that infects and replicates within…
Q: 4. The following applies for humans and not birds? A. lack of lymph nodes B. somatic DNA…
A: Recombination is the production of new DNA molecule (s) from two parental DNA molecules or different…
Q: Would you subject yourself to gene therapy without its 100% assurance of effectiveness or future…
A: Gene therapy is intended for the introduction into cells with genetic material to offset defective…
Q: 1. Explain the differences in the mechanisms of conjugation, transformation, and transduction.
A: Explain the differences in the mechanisms of conjugation, transformation, and transduction.
Q: 4. Describe how plasmids conferring multidrug resistanceto bacteria may have evolved.
A: A plasmid is small circular extrachromosomal materials present in bacterial or protozoan cells which…
Q: Production of pest-resistant plants 2. increase of milk production per cow 3. increase…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Which type of gene therapy involves the direct administration of viruses in patients' tissues? a.…
A: Gene therapy is an experimental technique that uses genes to treat or prevent disease. It is…
Q: (11) Genetic engineering utilized to create food sources has been said to be both like and unlike…
A: Genetic engineering is a set of molecular biology techniques that enable the scientists to…
Q: What is the function of the “junk DNA” in human genome? proper explanation and diagram
A: DNA (Deoxyribonucleic Acid) is the genomic material found in the cells of living organisms that help…
Q: How Did the Theory of Biogenesis Lead the Way for the Germ Theory of Disease?
A: The germ theory of disease is the theory that microorganisms are the cause of specific diseases, and…
Q: What is the importance of gene silencing in hereditary disease. What are the application of gene…
A: 1.The mechanism by which cells shut down large sections of chromosomal DNA is called gene silencing…
Q: 2.1 The advantage of an RNA vaccine over an adenoviral vaccine is: A) the RNA is short-lived and…
A: Vaccine provides active acquired immunity to the human’s against the specific organism. Thus vaccine…
Q: 1. Explain how CRISPR is the future of our society.
A: DNA sequencing is the process of determining the nucleic acid sequence. It is the order of…
Q: 1. Three basic steps of Genetic engineering * 2. Recombinant DNA technology has provided a broad…
A: INTRODUCTION Genetic engineering In genetic engineering we use recombinant DNA technology to alter…
Genetic Recombination
Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.
Microbial Genetics
Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.
1. What is the genetic event/process that enables antibiotic resistance to occur?
Step by step
Solved in 2 steps
- Within six months of effectively using methicillin to treatS. aureus infections in a community, all new S. aureus infectionswere caused by MRSA. How can this best be explained?(A) A patient must have become infected with MRSA fromanother community.(B) In response to the drug, S. aureus began making drugresistant versions of the protein targeted by the drug.(C) Some drug-resistant bacteria were present at the startof treatment, and natural selection increased theirfrequency.(D) S. aureus evolved to resist vaccinesThere have been recurring cases of mad-cow disease in the United Kingdom since the mid-1990s. Mad-cow disease is caused by a prion, an infectious particle that consists only of protein. In 1986, the media began reporting that cows all over England were dying from a mysterious disease. Initially, there was little interest in determining whether humans could be affected. For 10 years, the British government maintained that this unusual disease could not be transmitted to humans. However, in March 1996, the government did an about-face and announced that bovine spongiform encephalopathy (BSE), commonly known as mad-cow disease, can be transmitted to humans, where it is known as variant Creutzfeldt-Jakob disease (vCJD). As in cows, this disease eats away at the nervous system, destroying the brain and essentially turning it into a spongelike structure filled with holes. Victims experience dementia; confusion; loss of speech, sight, and hearing; convulsions; coma; and finally death. Prion diseases are always fatal, and there is no treatment. Precautionary measures taken in Britain to prevent this disease in humans may have begun too late. Many of the victims contracted it over a decade earlier, when the BSE epidemic began, and the incubation period is long (vCJD has an incubation period of 10 to 40 years). A recent study concluded that 1 in 2,000 people in Great Britain carry the abnormally folded protein that causes vCJD. In spite of these numbers, the death rate from vCJD remains low. It is not clear whether this means that the incubation period for the disease is much longer than previously thought, or whether they may never develop the disease. If you were traveling in Europe, would you eat beef? Give sound reasons why or why not.There have been recurring cases of mad-cow disease in the United Kingdom since the mid-1990s. Mad-cow disease is caused by a prion, an infectious particle that consists only of protein. In 1986, the media began reporting that cows all over England were dying from a mysterious disease. Initially, there was little interest in determining whether humans could be affected. For 10 years, the British government maintained that this unusual disease could not be transmitted to humans. However, in March 1996, the government did an about-face and announced that bovine spongiform encephalopathy (BSE), commonly known as mad-cow disease, can be transmitted to humans, where it is known as variant Creutzfeldt-Jakob disease (vCJD). As in cows, this disease eats away at the nervous system, destroying the brain and essentially turning it into a spongelike structure filled with holes. Victims experience dementia; confusion; loss of speech, sight, and hearing; convulsions; coma; and finally death. Prion diseases are always fatal, and there is no treatment. Precautionary measures taken in Britain to prevent this disease in humans may have begun too late. Many of the victims contracted it over a decade earlier, when the BSE epidemic began, and the incubation period is long (vCJD has an incubation period of 10 to 40 years). A recent study concluded that 1 in 2,000 people in Great Britain carry the abnormally folded protein that causes vCJD. In spite of these numbers, the death rate from vCJD remains low. It is not clear whether this means that the incubation period for the disease is much longer than previously thought, or whether they may never develop the disease. What measures have been taken to stop BSE?
- My 90's TVI ID Moviehdkh - Club * HesGoal.Com Spor... Due Wednesday by 1:40pm Available after Oct 27 at 12:50pm Points 25 Submitting an external tool Attempts 0 Allowed Atte PINEDA, JUCL DO 8 of 25 3 4 6 7 8 9. 10 11 12 Fir In the 1880s, Louis Pasteur developed a method of weakening viruses. The weakened viruses could be injected into healthy individuals. How is this method effective in fighting viral diseases? O The immune system develops antibodies in response to the weakened viruses. O The rate of genetic mutation in the host is decreased due to the introduction of weakened viruses. O Weakened viruses are unable to enter the host organism. O The weakened viruses attach to unaffected viruses in the host and interrupt the viral reproductive cycle.How hand sanitizer can help us to keep our hand clean especially during COVID-19 pandemic?Please answer with yes or no with correcting the falte statement. Felline to cottart the will cost the whole statements mark, 56) Prionsare small circular RNA Viruses, those viruses don't have capsid and they can't replicate in their own. They need & helper virus like hepatitis If virus to replicate 57) Car receptor can act as a receptor for multiple viruses, like adenoviruses and Herpesviruses. 58) For infiuenza viruses they enter the host cell via Clathrien-coated pits endocytosis; in which the cell receptors will be digested by the lysozyme enzymes 59) Uncosting is the removal of the outer capsid in order to release the genome to start the viral replication, In case of adenovirus the uncoalo appen.. membrane
- Aminoglycosides inhibit protein synthesis in bacteria. These class of antibiotics are considered to be ___ . none of these choices effective only against gram-negative bacteria effective only against gram-positive bacteria broad-spectrum antibiotics*what's contained in the flu vaccination*?The strain of Wolbachia from CalTech used in the infection experiments was nicknamed...? Zapper Zika Killer Рорсorn
- The worldwide spread ofmultidrug-resistant (MDR) pathogenicbacteria has becomean urgent threat to human and animalhealth. More than two million people inthe United States become infected withantibiotic-resistant bacteria each year, andmore than 23,000 of them will die fromtheir infections. In 2015, approximately480,000 cases of MDR tuberculosisoccurred worldwide and another 100,000cases were resistant to at least one antibiotic.In the United States, cases of drugresistantenterobacteriaceae infectionsincreased three-fold between 2001 and2012. In 2016, a woman in Nevada died ofa Klebsiella pneumoniae infection caused bya strain that was resistant to 26 differentantibiotics, including colistin, which is consideredthe “last resort” antibiotic.One factor leading to the spread ofMDR bacteria is the selective pressurebrought about by repeated exposure toantibiotics. Worldwide, livestock consume used as feed supplements. The routineuse of antibiotics in livestock feed and theoveruse of human…This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acidsCAN Corynebacterium diphtheriae be infected by a viruses. I know it is a bacteria but I need to know if it is possible for it to be infected by a virus. Please be specific but in terms that is easy to understand. PLEASE answer this specif question. I don't need to know the causes, effects, outcomes, etc of Corynebacterium diphtheriae. I already know that stuff, I need this specific question answered. THANK YOU.