What is the function of acetylcholinesterase? O a. to prevent undesired continuous contractions O b. maximize control over muscle contraction O c. to recycle acetylcholine O all of the above O a+ b, but no c

Q: Insects are ectothermic and the respiratory rate is usually proportional to the temperature of the…

A: TROPICS:- Insects adapt in the tropics by undergoing anatomical modifications. Example can be the…

Q: Species Species Cladogram Phylogenetic Tree Richness Evenness I. Cladogram vs Phylogenetic Tree…

A: Biology is a branch of science which deals with the study of living organisms and their interactions…

Q: Sketch a diagram to illustrate the interaction between MHC I molecules of the named cell type and…

A: The MHC I molecules are the major histocompatibility complex I which are present on the surface of…

Q: Q1 The cell shown in the diagram has been magnified 3000 times. The diagram is 21 mm wide. What is…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Outline the events in the innate and adaptive immune responses, from when a pathogen invades to…

A: Introduction  Immunity: it is the property/capability of our system to fight against the harmful…

Q: 1. You are observing an unknown vertebrate whose limbs are probably vestigial. What are the possible…

A: A limb is a jointed appendage in humans and numerous different animals use for locomotion like…

Q: Describe the cerebrum, cerebellum, and spinal cord's white and gray matter areas. Include the…

A: Cerebrum is the largest part of our brain, it is a part of forebrain. It is related to the…

Q: 5. In the following data, could the man be the father of the 6 children? Father Mother Children…

A: Inheritance  It is a natural biological process in which an individual gets its genome from their…

Q: Differentiate by drawing and describing the following and give distinguishing characteristic a.…

A: NOTE- as we are allowed to do only one question at a time. So I'm Providing answer to first question…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…

A: Parent  aabbccdd = 5lb AABBCCDD= 29 lb

Q: Worthiness of development 5= very worthy, 1= not worthy at all 5 4 3 2 1 Aspects Reasons Agriculture…

A: Genetic engineering, often known as genetic modifications, is the use of molecular techniques to…

Q: Which statement is NOT a key recommendation according to the current Dietary Guideline? Select one:…

A: Dietary guidelines provide advice on what to eat and drink for a healthy lifestyle. These help to…

Q: Describe the different potentials for regeneration of the three types of adult muscle after injury

A: Muscle tissue is made up of cells that have been differentiated in order to make the best use of a…

Q: 4. Why do you think is the classification of organisms important? 5. Do you personally agree with…

A: Introduction Biological classification refers to the process of arrangements of living organisms…

Q: 21. Which macromolecules always contain carbon, hydrogen, oxygen, nitrogen, and sulfur? A. nucleic…

A: Introduction:- Any exceedingly big molecule with a diameter ranging from roughly(105 to 103 mm) is…

Q: Discuss the process of eukaryotic transcription in details please.

A: Transcription is a process in which RNA is synthesized from the template strand of DNA. Like any…

Q: When KO techniques was developed ?

A: The full form of KO is knock out and refers to gene knock out which means the gene that is knocked…

Q: Name the three phases of an action potential. Describe for each the underlying molecular basis and…

A: An action potential is defined as the difference in neuron potential that occurs as a result of…

Q: G and g are dominant and recessive alleles respectively, for a gene. If a mating of a gg female with…

A: As given in the question that G is  dominant allele and g is recessive allele.

Q: METABOLIC METABOLITES DISORDERS Alkaptonuria SYMPTOMS DIAGNOSIS Phenylketonuria Gout Ketosis Fatty…

A: Liver is the largest digestive gland of the body it contains several enzymes to control and regulate…

Q: One of the most widely used means of communication among insects is chemical communication. How do…

A: Pheromones is a chemical released by an animal which ultimately changes the behaviour of a another…

Q: What are the promises and future uses of research in archaea?

A: Bacteria are microscopic single-cell prokaryotic organisms found in the environment. They are…

Q: b. What is the average charge of the amino acid at a pH of 10? Please round your answer to the…

A: The isoelectric point is the point at which amino acids carry no net charge.

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: - research and explain about the genetic drift  -differentiate founder effect from bottleneck…

A: Introduction Evolution:- Evolution is a process of gradual change in the characteristics of a…

Q: Complement can enhance phadocytosis because of the presence on macrophages and neutrophils of…

A: The correct option is C3b.

Q: In _______________ the selecting agent is the environment, whereas in _______________ the selecting…

A: Introduction Natural selection is the adaptation and modification of populations of living…

Q: What evidence led Emil von Behring to discover antibodies and the complement system in 1905?

A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…

Q: Can you please make a conclusion for this? Thank you so much!   Suppose you counted 79 R_ and 33…

A: Mendel's monohybrid cross involves the mating between individuals with different traits for a single…

Q: What are some of the favorable features that made Mendel choose peas?

A: Mendel proposed the laws of inheritance. It provided a mathematical basis for genetics. He chose pea…

Q: Turnover of RNA and protein helps to control gene expression by influencing the concentration of…

A: Gene expression is a process in which the genetic instructions of genes are utilized to manage…

Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…

A: Asexual and/or sexual reproduction are used by animals to make offspring. Both systems have benefits…

Q: a thymine dimer formed after UV radiation would be best described as a base substitution a base…

A: Mutation is the change in DNA sequence. Mutations can occur due to exposure to ionising radiation or…

Q: Following the arrival of an action potential in stimulated cells, synaptic vesicles rapidly fuse…

A: Action potential Is an instantaneous, fast, temporary, and spreading change in the resting membrane…

Q: consumption of six CO,molecules and twelve H,O molecules during oxygenic photosynthesis? A. one…

A: Option A is correct one C6H12O6 molecule, six H₂O molecules, and six O₂ molecules are produced

Q: _snRNP of the spliceosome recognizes to the 5' splice site through conventional base-pairing. These…

A: Splicing is a process that removes non coding sequence of genes from pre mRNA. Non coding sequence…

Q: number 32

A: Introduction:- A basic unit of heredity and a sequence of nucleotides in DNA that encodes the…

Q: What is opsonization? What is the role of antibodies in this process?

A: When the immune system recognizes foreign antigen enters in the body, complement activation occurs.…

Q: O Variolation had high infectious (10%) and death rates (up to 3%). Vaccination was much safer and…

A: INTRODUCTION  Variolation was an old method used for immunize infected persons against some deadly…

Q: 6. Which are greenhouse gasses? Carbon Dioxide CO, Methane CH Nitrogen N, oxygen O2 water H.O

A: Introduction:  Gases which absorb and emits radiant energy with the thermal infrared range that…

Q: T or F. Motor signals originating in the cortex can't interfere with motor reflex response? T or F.…

A: 1) the correct answer is - TRUE but it has restrictions upto a limit. This statement is neither…

Q: What are pressure sores or decubitus ulcers? Discuss some instances how this can occur to a patient?

A: Bedsores — also called pressure ulcers and decubitus ulcers — are injuries to skin and underlying…

Q: 1. You want to jump on the home-based food business bandwagon that sprang up during the pandemic.…

A: Fermentation   Fermentation is a biological metabolic process that convert glucose or sugar into…

Q: why are apples green red and yellow

A: Introduction :- Apple (Malus domestica), one of the most widely grown tree fruits, is the fruit of…

Q: 3. You are surveying an area's rock layers using absolute dating. You have an element whose…

A: Absolute dating is a method used by geologists and archaeologists to determine the age of a…

Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?

A: P21cip1 is small 165 amino acid protein that mediates p53 dependent G1 growth arrest.

Q: Which of the following is true about Liebig's Law of the Minimum?  A. The growth of a plant is not…

A: Justus von Liebig popularised Liebig's law of the minimum, also known as Liebig's law or the law of…

Q: Which microevolutionary force typically changes genotype frequencies without changing allele…

A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…

Q: Name the cells which are : (i) double negative T cells (ii) double positive T cells

A: T cells are a part of immune system and develop from stem cells in the bone marrow. They protect the…

Q: Make a simplified schematic representation of the connective tissue cell lineage derived from…

A: The connective tissue cell lineage derived from hematopoietic stem cells and their functions.

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.