what are the metabolic and physiologic capabilities of proteus Vulgaris? describe the different types of metabolism assessed for by physiology tests for proteus Vulgaris.
Q: Question 6 When light hits the special light-reactive molecular units inside rod cells, how do these...
A: Answer 6- One bond shifts positions from cis to trans orientation Answer7- cephalopods evolved eyes ...
Q: In the absence of Separase, how would this affect the chromosomes dynamic during mitosis?
A: Separase is an ubiquitous cysteine protease enzyme which remain inactivated (by forming complex with...
Q: petty larceny, killing animals, and was a bully. Sonny likely has personality disorder.
A: Answer is Option C AntiSocial. If a person having this Antisocial personality disorder he will be ve...
Q: Why did we add agar after we measure the pH?
A: pH means p stands for potential or power.H stands for Hydrogen atom.It is the power of the Hydrogen ...
Q: The electron-transport chain consists of a number of multi protein complexes, which work in conjunct...
A: Introduction FADH and NADH are examples of electron carrier which takes part in most of the redox b...
Q: contrast the embryonic development of the starfish and the sea urchin.
A: NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to answe...
Q: A reef that receives most of its fish recruits from other reefs and supplies few larvae to other ree...
A: * coral reef coral reef is in water can form of colonies of coral polyps of calcium carbonate.C * Co...
Q: Draw a graph based on the result. And give a short discussion
A: The growth of bacterial cells in culture can be assessed using the spectrophotometric method. In thi...
Q: in humans the condition for normal blood clotting dominates hemophilia these genes are x linked if a...
A: "ANSWER The sex chromosomes of the father are designated XY, with the X chromosome bearing the haem...
Q: How does the small intestine have such a large surface area? Why is a large surface area important? ...
A: The muscle groups of the small intestine mix meals with digestive juices from the pancreas, liver, a...
Q: 1. Describe what malaria is and where it is prevalent in what areas of the globe and in what habitat...
A: Often diseases are caused by various pathogenic microbes that are found in unhealthy and unhygienic ...
Q: QUESTION 3 Pumps (select all that apply) O Couple transport against electrochemical gradient to ATP ...
A: ---Pumps are kind of protein that is capable of pumping out compounds that could pose a threat to th...
Q: A gene that is essential to the existence of a bacterium (e.g., the 16S rRNA gene) would most likely...
A: Accessory genomes are genomes acquired by bacteria through horizontal transfer of genetic elements f...
Q: How can widely separated parts of a protein interact with the spike protein
A: Sharp bumps emerge from the surface of the outer envelopes of members of the coronavirus family. Spi...
Q: Explain comprehensively. a. How does evolution play a role in meiosis and sexual reproduction? b....
A:
Q: Extract from Soursop Leaves Can Prevent the Symptoms of Fibromyalgia"? a) The article doesn't discus...
A: The given article summarises the use of Annona muricata L. leaves for preventing fibromyalgia. It gi...
Q: (a) Name the three primary mediators of purinergic receptors. (b) Which one of these mediators is so...
A: (A) ATP, Adenosine, Phosphates can be considered as a primary mediators of Purinergic Receptors. (B)...
Q: Give examples of environmental factors that affect phenotype byaltering gene expression
A: Introduction Environment plays a major role in the diversification of organisms. For example, if we...
Q: Discuss the 4 lobes of the brain its function and relation to our behavior
A: Our brain is divided into 4 different areas that execute particular functions, these are known as lo...
Q: Q7. Meselson and Stahl conducted an experiment to prove that the replication of DNA is semi-conserva...
A: The experiment performed by Meselson and Stahl revealed the model of DNA replication.
Q: Question 8 What causes eyeshine in some animals like cats? O a reflective layer at the back of the e...
A: 8. ANSWER;- A reflective layer at the back of the eye that allows light to bounce around more, enhan...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
Q: A heterozygous individual has_____ for a trait being studied. a. the same allele on both homologous ...
A: There is a process of codominance in the heterozygotes when the two alleles are expressed in any phe...
Q: What are the main elements of the lac operon and their functions?
A: Operon is the the prokaryotic gene regulatory system in which the expression of polycistronic mRNA i...
Q: True or false? All traits are inherited in a Mendelianpattern.
A: Introduction A trait, also known as a character state, is a distinct version of an organism's phenot...
Q: Phenylethyl alcohol and why would it be useful in agar
A: Acoording to this question we have to decribe phenyl alcohol and the phenylethyl alcohol be useful i...
Q: B Red line F G E D Cornea [ Choose ]
A: The human eye is one of the sense organs that can detect vision by responding to light. The rods and...
Q: 1 11 9 10 Study the pedigree diagram of a sex- linked trait above and answer the following questions...
A: X-linked trait The trait or phenotype which is transfer with X- chromosomes are known as X-linked t...
Q: what are some of the advantages of knowing human anatomy and physiology
A: Human body is made up of several body structures which works in numerous ways to operate the body sy...
Q: hemoglobins interact with hemoglobin S and how can these be differentiated from hemoglobin C
A:
Q: What is the structure of double-stranded DNA as determined by Watson and Crick?
A: In 1953 Watson and cricks realized that DNA is made up of two chains of nucleotide pairs and double...
Q: Simian Virus 40 is carcinogenic in primates. 1). which molecule of the virus 2). what particular ...
A: Viruses come under the category of microorganisms (tiny creatures) that can be found in the environm...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A:
Q: Answer the following provided in the table. You may answer it briefly or by using a bullet. Charac...
A: Characteristics unique to seaweeds They have holdfast which help in attachment to hard surfaces th...
Q: Which of the following statements about the world population is NOT true?
A: Analysts estimate that the global carrying capacity of the earth is about 50 billion. The world popu...
Q: Can you tell me about a scientist that has advanced humanity's knowledge about malaria, please?
A: Malaria is a serious and sometimes fatal disease, it is a disease caused by a plasmodium parasite, t...
Q: Transphosphorylation of receptor tyrosine kinases: activates JAK2 inhibits catalytic ...
A: Transphosphorylation of receptor tyrosine kinase activates JAK2.
Q: 1. Which processes remove nitrogen from the atmosphere? I. Fertilizer production II. Eutrophication ...
A: The correct Answer is B1. B. Nitrogen-fixing bacteria fix atmospheric nitrogen gas, which is used to...
Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...
A: The hereditary material in humans and almost all other organisms is DNA or deoxyribonucleic acid. Th...
Q: Illustrate the basic structure of chromatin ?
A: The basic structure of chromatin is known by the name of the nucleosome. The chromatin can either be...
Q: With over 369,000 species of angiosperms alone, why do you think we get most of our nourishment from...
A: Angiosperms are plants that produce flowers and bear their seeds in fruits. They are the largest and...
Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...
A: The correct Answer is C
Q: Assume that the ratio of females to males is 1:1. A couple already has two daughters and no sons. If...
A: Introduction Probability is a statistical tool in genetics that lets us anticipate the likelihood of...
Q: 3. Which of the following forces is an at a distance force? O Friction O Normal O Applied O Gravity
A: At a distance forces are said to be those forces which acts even when two objects are not in any phy...
Q: When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pn...
A: Frederick Griffith was responsible for conducting an experiment using Streptococcus pneumoniae, whic...
Q: Which of the following statements concerning T cell development is correct? A. Progenitor T ...
A: * T cell are part of the immune system from which they develop from stem cells in the bone marrow. ...
Q: Match each term with the best description. ___ DNA replication a. basis of variation ...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: How did Griffith’s work provide a foundation for the experiments of Avery and his colleagues pointin...
A: Introduction In the past years when the genetic and molecular biology techniques were not so develo...
Q: write a short description to explain the morphology of graphide, styloid , prism , druse and crystal...
A: The above-mentioned terms infer the different shapes of Calcium oxalate crystals that are widely fou...
Q: 2. Describe the effect of the mutation that created the Hbs allele on the amino acid sequence of the...
A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during...
Step by step
Solved in 3 steps
- Discuss and explain in detail the effects of lifestyle changes on metabolic syndromeExplain, in basic terms, the metabolism of thaumarchaeotesA 9 year old mentally retarded girl with a protuberant abdomen, short stature, coarse facial features and cloudy corneas. skeletal malformations include dysostosis Multiplex and Bullet shaped middle phalanx .what is the enzyme deficient in this patient? A)Iduronate sulfatase B) beta - Galactosidase C)alpha - L- Iduronidase D) beta - Glucuronidase
- Write following about Thiamine (B1) in brief:- - Source - functions DeficiencyBesides obesity, give the other two possible causes of OHS. read the article “Obesity Hypoventilation Syndrome” https://www.thoracic.org/patients/patient-resources/resources/obesity-hypoventilation-syndrome.pdfWhat are the reasons why most of the clinical features of the diseases Fumarase deficiency and 2-oxoglutaric aciduria involve muscle and nerve tissue?
- What explains the observation that some forms of porphyria are associated with jaundice while others are not? Some porphyrias, but not all, are due to defects in heme metabolizing enzymes that cause a buildup of bilirubin, which causes jaundice. Some porphyrias, but not all, are due to defects in heme metabolizing enzymes that increase urobilin, which is yellow and concentrated in urine. Some porphyrias, but not all, are due to defects in ABO blood type enzymes that cause a buildup of bilirubin, which causes jaundice. Some porphyrias, but not all, are due to defects in heme metabolizing enzymes that cause a buildup of biliverdin, which is green in color. 271what is the role of FNP’s in reducing the severity of Anorexia Nervosa?Explain this table (shown in picture) from a study with the help of the information below and additional information from the article (shown in picture): Primary liver cancer is one of the most prevalent life- threating diseases in China, and liver resection is the major therapy for this malignancy. Recently, various methods have been advocated perioperatively to maintain liver function and promote liver regener- ation after liver resections. These include systemic interventions such as antibiotics in perioperative period and methods to improve general health and the immunity of the individual such as prebiotics and probiotics. Among them, nutritional support is also a vital approach to protect liver function. It has been demonstrated that a good preoperative nutri- tional status could reduce the postoperative morbidity or mortality and consequently the costs of care after surgery. Moreover, malnutrition is frequent in patients suffering from malignant liver disease. Optimization of…