What are functions of the M7G cap? Select all the apply. Slows degradation from the 5' end of the mRNA Slows degradation from the 3' end of the mRNA O helps start translation by recruiting the mRNA to the small ribosomal subunit O is the first nucleotide to be transcribed

What are functions of the M7G cap? Select all the apply. Slows degradation from the 5' end of the mRNA Slows degradation from the 3' end of the mRNA O helps start translation by recruiting the mRNA to the small ribosomal subunit O is the first nucleotide to be transcribed

Name: What are functions of the M7G cap? Select all the apply.O Slows degra
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What are functions of the M7G cap? Select all the apply.O Slows degradation from the 5' end of the mRNAO Slows degradation from the 3' end of the mRNAO helps start translation by recruiting the mRNA to the small ribosomal subunitO is the first nucle

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase
Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?