Tt O 8. What are the driving forces that promotes tertiary -3D and quaternary -4D structure formation of proteins. Provide specific examples of the interactions that drive the formation of 3D and 4D structures?
Q: Which of these situations would produce a Hill plot with a Hill coefficient less than 1? A purified…
A: A Hill plot is used to establish the cooperativity of ligand binding to a protein.NH (Hill…
Q: What is the purpose of adding hydroquinone? What is the purpose of washing the egg homogenate with…
A: Since you have posted multiple questions, we will provide solution only to the the first question…
Q: Explain the biosynthesis of acetylcholine.
A: Acetyl choline is an amino alcohol which consists of a quaternary amino group, ethylene bridge and…
Q: Dihybrid Cross 13 Problem 5: A SsYy x ssyy test cross. Which of the following genotypes would you…
A: The objective of this question is to determine which genotype would not be expected in the offspring…
Q: Was it appropriate to use human serum protein as the standard when you were analyzing egg proteins…
A: When analyzing egg proteins in unknown samples, using human serum protein as a standard may not be…
Q: This is the three-letter code for the amino acid that is the most geometrically constricted amino…
A: Amino Acids are the organic compounds that combine to form proteins, hence they are referred to as…
Q: Genetics Question 18
A: The question is asking whether the number of chromosomes in the cells produced at the end of meiosis…
Q: Many pharmaceuticals exert their action by inhibiting the activity of enzymes. Choose the false…
A: Enzyme inhibition occurs when certain substances, called inhibitors bind to and inactivate enzymes.…
Q: Sketch graphs expected for the Product concentration Vs substrate concentration.
A: Enzymes can be defined as proteins that help to speed up the metabolism. They basically act as…
Q: Sketch a typical enzyme kinetic curve of [S] vs. V. The maximum [S] should be about four times the…
A: In a typical enzyme kinetic curve, the substrate concentration, [S] is plotted along the x-axis and…
Q: Determine equilibrium constants for the hydrolysis of phosphoenolpyruvate (AG" is -61.9 kJ/mol) at…
A: In order to find the value of equilibrium constant (Keq), we need to convert temperature (T) to…
Q: To track cell growth and utilization of the limiting substrate in a bioreactor, the yield is…
A: S=Y(X0−S0)X−X0+S0Explanation:Lag Phase: The growth rate is zero (μ = 0) since there is no…
Q: 2. a) Energetics of the electron transport. In the oxidative phase of oxidative phosphorylation,…
A: Standard change in Gibbs free energy ( ) of redox reactions can be determined , if we know the…
Q: 54 In the alpha helix shown below, all carbonyl groups are pointing_ amino groups are pointing_…
A: Proteins show four levels of structural organisation. Primary level of organisation involves the…
Q: Enzymes are biological catalysts that decrease the activation energy necessary for a chemical…
A: Oxidoreductases are a class of enzymes that catalyze redox reactions. Oxidoreductases generally uses…
Q: Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose…
A: When considering the phosphorylation of glucose to form glucose 6-phosphate, we have:The standard…
Q: Genetics Question 24
A: The question is asking for the number of sister chromatids in a unicorn cell at metaphase of…
Q: Question 1: Look at table 17.2 to see the standard free energy changes for the steps in the CAC.…
A: Citric acid cycle is also called tricarboxylic acid cycle or TCA cycle or Krebs cycle. This is the…
Q: Genetics Question 17
A: The question is asking whether the number of sister chromatids in a cell at metaphase of meiosis 1…
Q: The reaction pictured is an oxidation-reduction reaction in the citric acid cycle in which the…
A: The objective of the question is to identify the molecules that undergo oxidation and reduction in…
Q: 4) Amino acids are polyprotic weak acids and are commonly used as biochemical buffering agents. You…
A: pH = 1/Log [H+]If [H+] concentration in a solution is high, pH will be low and the solution is…
Q: how does the protein porin cross the lipid bilayer in a cell membrane
A: The objective of this question is to understand the mechanism by which the protein porin crosses the…
Q: Please fill in the four boxes bolded below you KM (MM) Vmax (nM/s) Type of inhibition…
A: Competitive inhibitors are the substances which are similar to substrate molecules in their…
Q: 5. What is a saponification number? What does a high saponification number indicate? Name a lipid…
A: Biological macromolecules are the molecules that are required in sufficient quantity for the…
Q: Each ionizable group of an amino acid can exist in one of two states, charged or neutral. The…
A: If the pKa is low, the pH of the solution is less, and the acidity of the solution is high. i.e.,…
Q: Considering PNPP → PNP reaction, would you expect to see more intense or pale color for the reaction…
A: para-Nitrophenylphosphate (pNPP) is a chromogenic substrate for phosphatases used in…
Q: Question 7 Identify the functional groups in the following structures. HO 1. 12345 1. HO- 3. GAWNE…
A: There are various functional groups present in each organic molecule. A functional group is a group…
Q: Which of the following is true about a mixed type inhibition? a. None of these is true b. A…
A: The enzyme kinetics, inhibition in particular, is vital to understanding and purposefully managing…
Q: Question 4 Listen A gene known as H is epistatic to the ABO blood type genes. Based solely on this…
A: The question is asking us to determine which of the given options is possible based on the statement…
Q: provide an example of internal myopia, external myopia, and normative myopia in health care,…
A: Myopia is an eye condition where light from far-off objects focuses in front of the retina rather…
Q: Question 4
A: The objective of the question is to identify the origin of spindle growth during cell division.
Q: O Steps of Translation 1. 2. The ribosome looks for leaves the nucleus and binds to a Codon: group…
A: Translation is generally defined as a process in the living cells in which the proteins are…
Q: A polypeptide was treated with 2-mercarptoethanol and produced the following fragments: Fragment 1:…
A: Mercapto ethanol is a chemical most commonly used in peptide sequencing to reduce the disulphide…
Q: A protein has a molecular mass of 400 kDa when measured by size-exclusion chromatography. When…
A: Size exclusion chromatography is a technique which separates molecules according to their size…
Q: Create a concept map to demonstrate the relationships between carbohydrate, protein and lipid…
A: Catabolism is the breakdown of large molecules into smaller ones. This is often undertaken to…
Q: Please discuss the buffering capacity of an amino acid. In your answer include what is a buffer? Why…
A: Amino acids are organic compounds that serve as the building blocks of proteins. They have three…
Q: Design a cation exchange experiment to purify a protein with a pl of 4.2. Charge of the beads on the…
A: Amino acids are the constituent monomers of the polymer proteins. Amino acids have a characteristic…
Q: Genetics Question 13
A: The question is asking whether the proximity of two genes on a chromosome affects the number of…
Q: 4. In the reaction in which glyceraldehyde 3-phosphate is oxidized to 3-phosphoglycerate, which…
A: The process of oxidation and reduction in a reaction is collectively called Redox reaction. During a…
Q: Fill in the table below Monomeric units are called: What are unique monomeric units? Linkages…
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: Use the scoring system described to calculate the alignment score for IPNIA A IG D V VAG P VKGIYA V…
A: The alignment score is the sum of individual matches when two or more DNA or protein sequences are…
Q: Which of the following are attributes of a well-prepared graph? (Select all that apply.) O labels on…
A: In a laboratory manual, a graph typically refers to a visual representation of data collected during…
Q: How does HbS aggregation occur in sickle-cell anemia? Place the steps in the correct order. Note…
A: Sickling is seen in sickle cell anaemia where haemoglobin inside the RBC cells sticks together and…
Q: The Michaelis-Menten equation models the hyperbolic relationship between [S] and the initial…
A: Those proteins or biological catalysts which help to speed up the chemical reaction are termed…
Q: Identify the chemical basis for ApH and AW across the chloroplast thylakoid membrane by dragging the…
A: Chloroplast is an organelle that contains the photosynthetic pigment chlorophyll that captures…
Q: The enzyme that catalyzes the formation of the peptide bond is located: in the large ribosomal…
A: During translation amino acids get linked to each other via peptide bonds. The enzyme responsible…
Q: A circular double-stranded DNA molecule contains 4700 base pairs. In solution the molecule is in a…
A: The objective of the question is to calculate the superhelix density of a circular double-stranded…
Q: Question 6
A: The question is asking us to identify a characteristic that is unique to sister chromatids during…
Q: Describe how the SCAM analysis was performed so that it maintains replicatability.
A: SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…
Q: Dihybrid Cross Problem 9: Homozygous offspring of a dihybrid cross, again. In a dihybrid cross,…
A: The objective of this question is to determine the fraction of offspring that will be homozygous for…
Step by step
Solved in 3 steps
- GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met. Give two reasons to explain why a proline residue in the middle of an ahelix is predicted to be destabilizing to the helical structurea. Suppose that the R group of a histidine residue in a protein in its native tertiary structure is buried in the interior of the protein and is involved in a salt bridge (ionic interaction) with an oppositely charged residue. Unfolding the protein exposes both of the charged groups to water. Would you expect the pKa of the His R group (side chain) in the native protein to be a) higher or b) lower than the pKa of the same residue in the unfolded protein? Why? b. Is the exocyclic NH2 in cytosine acidic or basic? Why? NH, `N'
- GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? 1. Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. 2. 3. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-GIn-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetE. PROTEIN PRIMARY STRUCTURE ELUCIDATION. 1. Determine the primary structure of the protein described below. Write the final sequence using the corresponding three-letter code for each amino acid. Example: M-F-Y-R should be written as Met-Phe-Tyr-Arg Treatment with cyanogen bromide and sequencing yields the following peptide fragments: o D-M o R-A-Y-G-N o L-F-M Chymotrypsin digestion and sequencing yields the following peptide fragments: o G-N D-M-L-F o M-R-A-Y o oPlease ASAP. Thank you. How does the mutation change/affect the structure of the Hb heterotetramer (ie how is quaternary protein structure affected)?
- . A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3 Cys residues, located as shown below. Only one of the Cys has a free - SH group and the other two are involved in an -s-s- bond. A Phe Cys « N-terminus Cys- - Met Cys- C-terminus The only methionine and the only aromatic amino acid (Phe) in this protein are in the positions indicated. Cleavage of the intact protein (i.e., with disulfide bonds intact) by either cyanogen bromide or chymotrypsin does not break the protein into two peptides. Where is the -s-s- bond (i.e., AB, BC, or AC)?A. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH. Asp-His-Tyr-Arg-Lys-Leu-Thr-Gln. Based on the pKa value of the ionizable groups. B. A polypeptide consisting only of L-glutamate residues (poly-L-glutamate) may have a random coil or helical structure depending on pH. Explain this behavior by indicating at what pH values the helical structure will be favored.. Consider a small protein containing 101 amino acid residues. The protein will have 200 bonds about which rotation can occur. Assume that three orientations are possible about each of these bonds. (a) Based on these assumptions, about how many random-coil conforma- tions will be possible for this protein? (b) The estimate obtained in (a) is surely too large. Give one reason why.
- . Suppose you have two genetic variants of a large protein that differ only in that one contains a histidine (side chain pk, = 6.0) when the other has a valine (uncharged side chain). (a) Which would be better for separation: gel electrophoresis or isoelectric focusing? Why? (b) What pH would you choose for the separation?. Assume that some protein molecule, in its folded native state, has one favored conformation. But, when it is denatured, it becomes a "random coil," with many possible conformations. (a) What must be the sign of AS for the change: native → denatured? (b) How will the contribution of AS for native → denatured affect the favorability of the process? What apparent requirement does this impose on AH if proteins are to be stable structures?GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified protein.