Q: 19. Which of the following is true about cardiac muscle? A. It is voluntary and striated B. It is…
A: Muscles These are soft tissues. There are three types of muscles in human body. These are: Smooth…
Q: Write the characteristics of the seven taxonomic hierarchy in sentences/ paragraph and their…
A: The seven taxonomic hierarchy is.. species, Genus, Family, Order, Class, Phylum or Division and…
Q: explain why there are more similarities between humans and chimpanees than between human and dogs.
A: Monkeys, chimpanzees, and humans are primate groups. Primates are vertebrates that are portrayed by…
Q: Using a T chart illustrate the differences between type I diabetes and type II diabetes.
A: Introduction Diabetes is a group of disorders that impact your body's ability to use blood sugar…
Q: Which of the following organisms practice internal fertilization and external development. Chickens,…
A: Introduction :- Internal fertilisation is the joining of an egg and sperm cell inside the female…
Q: NUMBER OF CARBON GAS (CO2) IN THE ATMOSPHERIC AIR 1.0,03-0,04% 2. 0,07 3. 0,1 4. 0.3 5. 4,0
A: Earth's atmosphere is composed of about 78% nitrogen, 21% oxygen, and one percent other gases.
Q: Why do yeasts generally have to be cultured for longer periods than most bacteria? Can…
A: Note :-Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: Question 1 a. What are the potential roles for calcium sparks in cardiac disease states? b.…
A: The ABO blood grouping is regulated by a single gene present on chromosome 9 and such gene is…
Q: How can you protect yourself from diseases that can be acquired from the environment?
A: 1)Good hygiene: the most important way to prevent infectionsThe first line of defense is the control…
Q: How does the Red Queen hypothesis affect coevolution between host species and parasites?
A: Introduction A parasite is an organism that lives on or in its host and feeds on or at the expense…
Q: Phosphorylase kinase integrates signals from thecyclic-AMP-dependent and Ca2+-dependent…
A: Phosphorylase kinase which is abbreviated as PhK, has the responsibility to coordinate hormonal as…
Q: What role does each component of the ear play in transmitting vibrations that enter the outer ear…
A: The ear is a vital organ that is responsible for both hearing and maintaining body balance. The…
Q: What are the importance tof ants o other organisms and to the environment
A: The ant is one of the world's most strongest animals comparable to its size. A single ant can carry…
Q: First food chain Second food chain Trophic level Organism Trophic level Organism
A: First food chain Trophic level organism Level 1 (Producer) Diatoms and other phytoplankton.…
Q: Examine the variegated leaf shown in Figure Q14–3.Yellow patches surrounded by green are common,…
A: Chloroplast and mitochondrial DNA are usually define the that they are been maternally inherited in…
Q: 1. oxidability 2. residual chlorine 3. ammonia 1. nitrites, nitrates 5. chlorides 5. sulphates
A: Chlorination is the process of adding chlorine to drinking water to kill parasites, bacteria, and…
Q: i need the answer quickly
A: Dust is of following types: - Visible Microscopic Ultra Microscopic Visible is filtered out at the…
Q: Which of the following - if it had occurred - would have resulted in the myxoma virus in Australia…
A: Introduction Myxoma virus is a poxvirus in the genus Leporipoxvirus. Myxomatosis is caused by the…
Q: If a plant’s stomata are made to stay open at all times, orclosed at all times, it will die. Why?
A: Stomata are the tiny holes which are present on the surface of the leaves. The function of the…
Q: 1. Here is how to start. You have to show the derived characteristic for each phylum (red) on top of…
A: Derived traits and Primitive traits Every individual bears some kind of characteristics specifically…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: DUST PARTICLES HAVING MICROSCOPIC SIZE (0.25-10MKM) 1. quickly within a few minutes settle according…
A: According to the dispersity, dust particles are comprised of different sizes- visible (greater than…
Q: THE EFFICIENCY OF NATURAL VENTILATION IS DETERMINED BY 1. the frequency of air exchange 2. the…
A: Natural ventilation is one of the most basic methods for reducing energy use in buildings. The need…
Q: The intracellular matrix differs from the extracellular matrix in that the latter is located A…
A: Q. The intracellular matrix differs from the extracellular matrix in that the latter is located A…
Q: This pedigree chart shows the transmission of a trait in a particular family. Based on this pattern…
A: Answer is mitochondrial pattern of transmission. In mitochondrial transmission, disease is…
Q: Compare the characters of lemuroidea , Tarsioidea and Arthropoidea. Pls make a chart or table so I…
A: Lemuroidea , Tarsioidea and Arthropoidea are the 3 suborders of order primates, and subclass theria…
Q: With the exception of olfaction, all sensory pathways first travel to the ________, which acts as a…
A: Introduction :- The thalamus is a diencephalon structure that is primarily grey matter and plays…
Q: giving examples to illustrate your answer define both selective media and enrichment media as might…
A: Every microbiologist must eventually grow bacteria in the lab for research purposes. Bacterial…
Q: Gregor Mendel: CHECK ALL THAT APPLY conducted research that proved that the "blending hypothesis"…
A: Introduction Gregor Mendel:- He was an Austrian scientist, teacher, and Augustinian prelate who…
Q: 4. Give at least 2 major contributions of Cambrian explosion to evolution
A: 4. The Cambrian Period is significant in the evolution of life on Earth since it is when most of the…
Q: What did Enterobacter aerogenes to do with the Lactose negative go to the Serratia liquefaciens?…
A: Enterobacter aerogenes is a gram negative rod shaped bacteria that causes several infections in the…
Q: How could you prove that the Tn5 insertion was in the lac operon?
A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…
Q: In contrast to our jaws. which move up and down, the mouthparts of arthropods move side to side.…
A:
Q: Define the following terms: a. Chermolithoheterotroph b. Microaerophile c. Chermoorganoheterotroph…
A: The living world, as we all know it, can predominantly be divided into - Plants and Animals. Apart…
Q: AT THE ESTIMATION OF THE VALUE OF THE COEFFICIENT OF NATURAL LIGHTING, USE THE DEVICE 1. Krotov's…
A: Krotovs apparatus used for bacteriogical air research. Cathetertometer is urine meter. Anemometer…
Q: discuss an autoimmune disease
A: Introduction The immune system is a complex system of the body that includes cellular as well as…
Q: 1. Explain in 2 sentences why Evolution walks a perilous tightrope between continuing and ending.
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…
A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…
Q: Genotypic Ratio: Phenotypes: Phenotypic Ratio: Rr Genotypes. Genotypic Ratio: Phenotypes: Phenotypic…
A: In order to explain the inheritance pattern Mendel gave three laws -law of dominance, law of…
Q: Not all Americans are willing to get the covid-19 vaccine, and not all countries have enough…
A: Vaccination : A biological preparation that can be used to activate the immune response in the body…
Q: The diagram below represents results of agarose gel electrophoresis performed after PCR…
A: Please follow step 2 for detailed explanation.
Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…
A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…
Q: vascular cylinder, vascular bundle, ground tissue, epidermis , palisade mesophyll, spongy mesophyll,…
A:
Q: 2. Why is oxygen when unbound to any other material can be toxic to life? 3. What is the role of…
A: 2. By its proclivity for univalent reduction, which results in the production of reactive oxygen…
Q: 4. The difference in charge between the outside and the inside of a neuron at rest is called: A.…
A: Introduction Membrane potential:- It is a potential gradient that forces ions to passively move in…
Q: Calculating the probability of two parents - each coming from a large family with a history of a…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: Assume for a moment that crossing-over did not occur. Would you agree that you received half of your…
A: Crossing over is a phenomenon that develops in novel gene combinations by transferring and swapping…
Q: Please i really need the right answer there is mutiple queshtions and i need the right answer and…
A: B is the correct answer. Multiple alleles occur when there are more than two possible alleles for a…
Q: Portal System 1. What visceral organ system uses the portal system extensively?
A: Portal system in the body can be defined as a system in which blood present in one set of…
Q: Label the structures of the lymphatic system in the accompanying figure. ch Lymphatic vessel…
A: Lymphatic system Lymph is a colourless fluid that contains the immunity cells or the white blood…
Can you explain why the answer is true or false for this question?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Indicate the order in which the following steps would take place to result in Parapatric Speciation [enter 1 for the first step, 2 for the second, etc; write only the number -- no words, no spaces] Something happens so that the environment is different in one part of the range relative to the other, even though the populations are still contiguous. As they adapt to their specific environments, the fitness of any hybrid formed is reduced. The populations adapt to their environment in the part of the range where they live. Interbreeding populations connected via gene flow occur across a range. Reproductive isolating mechanisms are selected for so that less fit hybrids are not formed. Two species now exist.in what ways would you expect forced migration to have an impact on the phenotypes of animal populations over the next 100 years? What are expected impacts on the genetic structures of these populations?Imagine that the volcano on Mt. St. Helens erupts again. All life is removed from the side of the mountain and has to recolonize. Your first task as a geneticist for United States Forest Service is to estimate the frequency of the red allele in the lupine plants that colonize the site. You know that the lupine seeds came from a nearby population where the frequency of the red allele has consistently been approximately 0.2 for many generations. However, in the first year (i.e. first generation, before any local reproduction) on Mt. St. Helens, the red allele of this newly colonized population has a frequency of 0.9. What is the most likely explanation for this difference in allele frequency from the nearby population?
- The following table provides phenotypic data for a population of mammoths living in cold environments based on fossil and DNA evidence. Based on this data and your knowledge of natural selection, which explanation best explains the trends seen in the data? Individuals with thicker fur had a survival advantage in the cold environment, allowing these individuals to reproduce more often and create more offspring. Individuals within this population of mammoths tend to only mate with individuals that have thick fur. This population of mammoths appear to be in Hardy-Weinberg equilibrium since no allele frequencies are changing over time. Individuals with thick fur migrated into the population of mammoths, increasing the proportion of these individuals.Over time, enough genetic variations can develop within a population to cause it to undergo speciation. Identify the various mechanisms that will prevent different species from being able to reproduce successfully. Which of these mechanisms is the most influential in keeping species sperate?Which of the following is the LEAST CONVINCING argument against micromutationism? Advantageous mutations of large effect are more resistant to loss by drift than advantageous mutations of small effect. Mutations of small effect are more likely to be advantageous than mutations of large effect. Empirical studies suggest that some adaptive traits are governed at least in part by loci of large phenotypic effect.
- A group of four birds flies to a new location and starts a newcolony. Three of the birds are homozygous AA, and one bird isheterozygous Aa.A. What is the probability that the a allele will become fixed in thepopulation via genetic drift?B. If fixation of the a allele occurs, how long will it take?C. How will the growth of the population, from generation togeneration, affect the answers to parts A and B? Explain.Evolution is driven by both nonrandom and random mechanisms. Identify the mechanisms of evolution that are random and comment on how they affect allele frequencies across generations.A preserve contains the last population of the very rare desert pupfish which is only found in one pool. There are two color forms of this pupfish, one is silver and one is black and the color is inherited. The color forms are equally successful in surviving and having offspring over the long term but the frequency of the two forms varies greatly from generation to generation. Which evolutionary force is causing the fluctuation in frequency?
- Two hundred years ago, the fly species Rhagoletis pomonella only laid its eggs on fruit of the hawthorn tree. Today, different "host races" of R. pomonella lay their eggs on hawthorns OR apples. Apples occur within the range of hawthorns, so divergence between apple flies and hawthorn flies could be the first step in sympatric speciation. Choose the evidence that would suggest that R. pomonella is currently undergoing sympatric speciation. Check ALL answers that apply. A. Apple flies and hawthorn flies are able to form fertile hybrids. B. Apple flies and hawthorn flies are physically indistinguishable from each other. C. Apple flies typically mate with apple flies, and hawthorn flies typically mate with hawthorn flies. D. Apple flies and hawthorn flies emerge from their hosts at different times of the year.On the right is a figure showing the reconstructed route of colonization of a rodent species found on the continent and four offshore islands, A, B, C, and D. Since the ocean currents around these islands are extremely strong, you suspect that these colonization events are rare, likely have happened only once. To estimate the overall genetic diversity of each population, you surveyed alleles frequencies of several neutral loci. Which of the following statements is correct? D Continent B The genetic diversity would be the highest on island D because all migrations ended up on the island. If the level of genetic diversity is plotted against the distance from continent, we would expect to observe a steady increase of genetic diversity as the distance becoming farther away from the continent. The genetic diversity on island A would be lower than that of the continent because there is selection on the island removing deleterious alleles. This is an example of founder effect. All of the…On the right is a figure showing the reconstructed route of colonization of a rodent species found on the continent and four offshore islands, A, B, C, and D. Since the ocean currents around these islands are extremely strong, you suspect that these colonization events are rare, likely have happened only once. To estimate the overall genetic diversity of each population, you surveyed alleles frequencies of several neutral loci. Which of the following statements is correct? The genetic diversity would be the highest on island D because all migrations ended up on the island. If the level of genetic diversity is plotted against the distance from continent, we would expect to observe a steady increase of genetic diversity as the distance becoming farther away from the continent. The genetic diversity on island A would be lower than that of the continent because there is selection on the island removing deleterious alleles. This is an example of…