This is a catalase-positive, coagulase-negative, gram-positive coccus isolated from a urine specimen from a 20-year-old female college student. The image shown is a Mueller Hinton plate streaked with a 0.5 MacFarland standardized inoculum and a 5 microgram disk of novobiocin after overnight incubation. What is the identification of the isolate? Please select the single best answer Staphylococcus epidermidis Staphylococcus aureus Staphylococcus saprophyticus Staphylococcus lugdenensis
Q: Match the following steps of oxidative phosphorylation in increasing order from beginning (1) to end…
A: Oxidative phosphorylation is the process by which oxidation of NADH and FADH2 by the complexes in…
Q: 18. A biochemist has a 0.1000 L sample of a globin protein at a concentration of 0.0500 M. The P50…
A: Recall that: Fractional Saturation (θ) is the fraction of protein molecules saturated with a ligand.…
Q: Discuss the cellular location and biological significance of the processes of the citric acid cycle…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: what are the features which set the G protein family of receptors apart?
A: G protein-coupled receptors (GPCRs) are regarded as one of the most extensive families of validated…
Q: Which of the following are the precursors in synthesizing myristic acid? a. 7 malonyl-CoA b. 3…
A: Myristic acid is a common fatty acid. It has 14 carbons. Its molecular formula is CH3(CH2)12COOH. It…
Q: give an example of how signal transduction plays a role in disease
A: Introduction: Our human body undergoes various processes to coordinate individual cells to support…
Q: Which of the following factors favor fatty acid synthesis in liver cells when blood glucose levels…
A: The body utilizes carbohydrates as the primary source of energy. The excess carbohydrates after…
Q: Sulfur compounds give onions their unique flavor and properties. Compound 1 is the starting material…
A: Allinase is an enzyme which catalyzes a biochemical reaction in which S-alkyl-L-cysteine S-oxide…
Q: how does high pressure O2 treat CO poisoning?
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: The following assays is/are considered a DIRECT ASSAY: A. absorbance B. рн C. Viscosity D. All of…
A: Process of analyzing a substance to determine its composition or quality is an assay. In medicine,…
Q: Give one example of a disease related to heart and briefly explain the molecular basis of the…
A: The human body, just like any other complex lifeform (or even simple lifeforms ) functions as a…
Q: Peptides have been discovered that display anti-inflammatory properties and show promise as new…
A: MTADV is a synthetic pentapeptide which can be a potential novel drug with anti-inflammatory…
Q: Which of the following polypeptides would be most likely to form an a helix? Explain your answer.…
A: A polypeptide chain folds into a protein in its native, three-dimensional form through a process…
Q: Which of the following translocases serves as the central entry gate for cytosolic precursor…
A: A newly synthesized protein in the cytoplasm is transported into the target site through a process…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: Bond Type: Description: ОН CH2OH ОН ОН ОН Н ОН От CH₂OH ОН Н OH-0 ОН Н ОН :CI: Nat :ci: Nat Na :CI:…
A: Chemical bonds are formed between the same or different atoms to give rise to chemical compounds.…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: Dihydrofolate reductase is used twice for the reduction of folate to tetrahydrofolate. 2.…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. Sometimes enzymes…
Q: describe the principal reactant and products of major steps of glucose oxidation
A: Three distinct metabolic pathways are involved in cellular respiration, which is where glucose…
Q: You are sequencing the following DNA molecule 3'- GACTACCGAAATTAT-5. Assume the annealing primer…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: draw a guanine nucleobase and label all possible H bond donor and H bond acceptor?
A: H bond donor are those groups containing a H bonded to a electronegative atom (F,O,N) and H bond…
Q: One of the functions of the pentose phosphate pathway is to make NADPH, which plays important roles…
A: Nicotinamide adenine dinucleotide phosphate (NADP+) is used as a cofactor in anabolic reactions.…
Q: Students carry out a laboratory experiment with avidin (a protein in eg white) having a very high…
A: Enzymes are proteins that catalyse biochemical reactions. Sometimes enzymes require a non-protein…
Q: These functional groups act as acid/ base catalysts: A. His imidazole B. Thiol of Cys C. Guanidino…
A: Acid base catalysis is most common type of catalysis mechanism utilized by most of the enzymes like…
Q: The genetic code is said to be degenerate. This means that each codon codes for more than one amino…
A: INTRODUCTION: Genetic code - The genetic code is defined as the set of rules or instructions which…
Q: From the following information determine the amino acid sequence of a peptide. N-terminal Edman…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: 5. Explain in quantitative terms the circumstances under which the following reaction can proceed in…
A: Positive delta G means that the reaction cannot occur spontaneously. If delta G is negative then it…
Q: (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein…
A: Inhibitors are the molecules that slow down or completely block the protein activity of molecules,…
Q: SEMINAR TOPIC Role of oxidative stress in the pathogenesis and complications of diabetes
A: Oxidative stress is caused by disparity between production and accumulation of oxygen reactive…
Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…
A: In the cellular environment, the condition do not allow biochemical reactions to occur at…
Q: Question 15 The GroES subunit has 14 identical 549-residue subunits arranged in two stacked rings…
A: GroEL-ES is a molecular chaperone complex that assist in the folding of cellular proteins. The…
Q: Which of the conditions would result in the greatest amount of transcription of the lac operon? I.…
A: Gene expression essentially involves the production of the polypeptide chain that a certain gene has…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…
A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…
Q: Compared to an uncatalyzed reaction, an enzyme-catalyzed reaction ________. A) uses less substrate…
A: Enzyme kinetics is the study of the rates of chemical processes that are catalyzed by enzymes. The…
Q: PJA01 Based on your knowledge of local anesthetic SAR, which of the following drugs will block the…
A: Local anesthetics (LA) are drugs that block the sensation of pain caused by injury or a surgery.…
Q: 1. Calculate a creatinine clearance and its reference range. 2. Explain the biochemical formation…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Before myristic acid (14:0) can be oxidized to carbon dioxide and water, it must first:
A: Fatty acid catabolism involves beta oxidation followed by metabolism of the Acetyl CoA molecules…
Q: The carbon-carbon bond distance for single-bonded carbons, such as those in a saturated fatty acyl…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: what is bioenergetics ?
A: The scientific field of biochemistry focuses on all the chemical and biological processes involved…
Q: Which of the following mutations is most likely to cause a loss of protein function? O a. Silent…
A: As per the central dogma of biology, the genetic information stored in the DNA is copied onto an…
Q: What must happen first in order for dietary fats (triacylglycerols) to be digested? wandering AFTERS…
A: Fats (i.e. triacylglycerols) are hydrophobic. Once ingested, most of the fats reach the intestine…
Q: 1 what is the final electron acceptor in the electron transport chain 2 in oxidative…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: ) Describe the 10 enzymatic reactions of glycolysis and the organization of the pathway in 2 main…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: The enzyme that decarboxylates pyruvate before it gets converted to Acetyl CoA is a. Pyruvate…
A: Citric acid cycle is a metabolic pathway that converts carbon atoms to CO2 and, in doing so,…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: Casein is a phosphoprotein found in milk and so also called as milk protein. It has an isoelectric…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: Which of the following statements is/are CORRECT? A) Phosphoenolpyruvate carboxykinase is inhibited…
A: Gluconeogenesis is the metabolic pathway in which Glucose is synthesized from non carbohydrate…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: Discuss regulation of glycolysis and the citric acid cycle, including likely activators and…
A: 3 enzymes of glycolysis are regulated . They are; Hexokinase, Phosphofructokinase-1 (PFK-1) and…
Q: In determining the activity of an enzyme of choice, which do you prefer, monitoring the product…
A: Enzymes are biological catalysts that enhance biochemical reactions in living organisms. The…
This is a catalase-positive, coagulase-negative, gram-positive coccus isolated from a urine specimen from a 20-year-old female college student. The image shown is a Mueller Hinton plate streaked with a 0.5 MacFarland standardized inoculum and a 5 microgram disk of novobiocin after overnight incubation. What is the identification of the isolate?
Please select the single best answer
Staphylococcus epidermidis | |
Staphylococcus aureus | |
Staphylococcus saprophyticus | |
Staphylococcus lugdenensis |
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is this organism? And what other test could be done to confirm it's identification? 1.Gram stain - positive cocci, chains Catalase - weak positive Hemolysis - beta BE - positive NaCl- positive Bacitracin - no zone of inhibition PYR - positive Answer: Enterococcus spp. CAMP test to verify the identity 2.Gram positive cocci, chains Catalase - negative Hemolysis - alpha BE - negative NaCl - negative P disk - resistant Bile Solubility - negative Answer - viridans group, Use PYR test to verifyList the following to determine the unknown bacteria: Streptococcus mutans 1) Morphology & Characteristics 2) the different biological tests to be doneAt autopsy, the most prominent findings were bronchopneumonia with focal organization and hemorrhage in the right lung. Stains of the lung tissue were negative by Gram, methenamine silver, and acid-fast methods, but Dieterle silver stains revealed short bacilli. Lung cultures yielded Gram-negative bacilli, which grew aerobically on buffered charcoal-yeast extract, but not on blood or chocolate agar. The organisms resembled Legionella, but failed to stain with immunofluorescence conjugates for Legionella pneumophila and multiple other species (L minded, L longbeachae, L gormanii, L dumoffi, L bozemanii). The organism was sent to the Centers for Disease Control and Prevention, where it was eventually identified as a new species of Legionella. What is the most probable source of this man's infection? Family member Water Food Insect Bioterrorism Dark-field microscopy may be used to diagnose spirochetes in which of the following scenarios? To detect spirochetes in the blood of a…
- I AM TRYING TO IDENTIFY THIS UNKNOWN. ***IMAGE 1 HAS TWO PICTURE OF CATALASE TEST AND BLOOD AGAR TEST. ***IMAGE 2 HAS THREE TESTS CONDUCTED ON IT, OXIDASE, BACITRACIN AND NOVOBIOCIN. I believe it is one of the following: 1) S. pyo. 2)S. agal . 3)S.pneu. 4)E. faecalis 5)S. aureus 6)S epi. 7)S. sapro. 8)M. luteus Please let me know which one of the above is thge unknown. You have pictures of the unkown on Catalase and Blood Agar and three test conducted on Oxidase, Bacitracin and Novobiocin. Give reasoning as why you think it will be one of the above. Explaing the characteristics and what made you deicide it?Given: Enterobacteriaceae, Vibrionaceae, Pasteurellaceae and other organisms such as Calymmatobacterium, Cardiobacterium, Chromobacterium, Eikenella, Gardnerella, Streptobacillusand Zymomonas Test Unknown Isolate B 1 Luminescence Positive 2 Cell Shape Straight Rods 3 Gram Staining Negative 4 Oxygen Requirement Facultative Anaerobe 5 Motility (Hanging Drop) Motile 6 Growth at 0% NaCl Negative 7 3% NaCl Positive 8 6 % NaCl Positive Attached is the sampleYou are working in a lab studying Streptococcus pyogenes as a cause of necrotizing fasciitiis. You have an overnight culture that you want to know the starting concentration of, so do a set of six 1:10 serial dilutions (putting 1 mL from the stock into a 9 mL blank), with tube #1 being 1:10, #2 is 1:100, etc. You plate 0.1 mL from tube 5 onto a blood agar plate and the next morning count 134 colonies. How many bacteria (measured in CFU/mL) were in the overnight culture flask? A. 1.34 x 10^4 CFU/mL B. 1.34 x 10^5 CFU/mL C. 1.34 x 10^6 CFU/mL D. 1.34 x 10^7 CFU/mL E. 1.34 x 10^8 CFU/mL F. cannot tell based on the data given - you'd need to know the volume of the original culture flask
- Below are morphological, physiological and biochemical characteristics of an unknown luminous bacterium isolated from the gills of a marine fish. Use the data below to identify the isolate. Make an identification scheme Test Unknown Isolate B 1 Luminescence Positive 2 Cell Shape Straight Rods 3 Gram Staining Negative 4 Oxygen Requirement Facultative Anaerobe 5 Motility (Hanging Drop) Motile 6 Growth at 0% NaCl Negative 7 3% NaCl Positive 8 6 % NaCl Positive 9 Accumulation of PHB Positive 10 Flagella 1 Polar 11 Oxidase Positive 12 Nitrate Reduction 13 Gelatinase Negative 14 Growth at 35OC Positive 15 Growth at 4OC Negative 16 Methyl Red Positive 17 Voges-Proskauer Positive 18 Catalase Positive 19 Starch Hydrolysis Negative 20 Lysine…Why is glucose not the choice of carbohydrate for most differential media used in the identification of gram (-) enteric bacilli?What is the microbiology laboratory test that Identifies Pseudomonas maumuensis and what are the results of the tests that identify it? please include your sources in MLA. examples are hemolytic tests, lipid concentrations, genomic tests etc.
- A culture of Staphylococcus of unknown density is diluted as follows (letters represent each step): • 60 mL of a bacterial culture is diluted by adding 440 mL of water • 1000 microliters from (A) is added to 9 mL of water • Dilution (B) is used to prepare a 103 dilution in water • 100 ul from dilution (C) is plated to nutrient agar and incubated at 37°C Following incubation, colonies are uniformly distributed on the agar, and 102 colonies are counted on one half of the plate. 1. Express the total CFU/mL of the original culture in scientific notation. 2. If 10 ul is plated from dilution (C), how many colonies should grow on the plate? Edit View Insert Format Tools TableI AM TRYING TO IDENTIFY THIS UNKNOWN. ***IMAGE 1 HAS TWO PICTURE OF CATALASE TEST AND BLOOD AGAR TEST. ***IMAGE 2 HAS TWO TESTS CONDUCTED ON IT, BACITRACIN AND PYR I believe it is one of the following: 1) S. pyo. 2)S. agal . 3)S.pneu. 4)E. faecalis 5)S. aureus 6)S epi. 7)S. sapro. 8)M. luteus Please let me know which one of the above is thge unknown. You have pictures of the unkown on Catalase and Blood Agar and three test conducted on Bacitracin and PYR. Give reasoning as why you think it will be one of the above. Explaing the characteristics and what made you deicide it?A patient with AIDS is hospitalized with symptoms of high fever and rigidity of the neck. Routine laboratory tests on the CSF show a WBC count of 100/m L with a predominance of lymphocytes and monocytes, glucose of 55 mg/dL (plasma: 85 mg/dL), and a protein of 70 mg/dL. The Gram stain shows a questionable starburst pattern. Questions: a. What additional microscopic examination should beperformed?b. If the test is positive, what is the patient’s diagnosis?c. If the results of the test are questionable, what additionaltesting can be performed