The transcription factors would recognize and bind to nucleotides between the positions _____________________________. Group of answer choices A. +1 to +55 B. -1 to -22 C. -16 to -22 D. +1 to +
Q: Explain the types of Calcium oxalate crystals with drawing?
A: More than 200 higher plant groups, comprising gymnosperms and angiosperms, include calcium oxalate c...
Q: Scientific inquiry is a set of strategies that scientists use to gather information and explain the ...
A: Introduction Science deals with the understanding of the natural phenomena that occurs in daily lif...
Q: How would the methylation of cystosine affect the following; 1. Its ability to base pair with guanin...
A: Structurally methylation does not affect the base-pair hydrogen bonds,4 but decreases the twist and ...
Q: John and Maggie are expecting a child. John's great-grandmother (mother's lineage) and Maggie's brot...
A: Introduction A genetic characteristic or condition can be passed down from one parent to the next th...
Q: I have four amino acids: serine, histidine, alanine, and tyrosine. How many different primary struct...
A: Proteins are important molecules in the body which carry out all the essential functions of the body...
Q: how did Alfred Russel Wallace change public perception of Darwin's ideas?
A: After a variety of zoological discoveries, Wallace proposed a theory of evolution which matched the ...
Q: Describe and compare (advantages and disadvantages) of TWO methods to determine oxygen absorption ra...
A: Fermentation process can be observed in the environment on a daily basis.(Example: Fermentation by l...
Q: Part 2: Data Tables Table 1: Parent Genotypes: Monohybrid Crosses Generation Genotype of Individua...
A: A monohybrid cross is a cross between two genuine breeding parents that differ in only one feature. ...
Q: What is the biology of Schizophrenia ?
A:
Q: HELP PLEASE !! You are looking at a region of the genome that codes for a gene involved in enamel s...
A: ORF finder searches for open reading frames (ORFs) in the DNA sequence you enter. The program return...
Q: Chemotrophic energy metabolism is a catabolic and exergonic process that produces ATP from oxidizing...
A: Chemotrophs are organisms that get energy through the oxidation of electron givers in their environm...
Q: 2 please and thank you!!!
A: A colony-forming unit (CFU) is a unit that is used in microbiology to measure the viable number of b...
Q: Many connective tissues like cartilage, ligaments, tendons skin dermal layers secrete an extra cellu...
A: Connective tissue is tissue that supports, protects, and gives structure to other tissues and organs...
Q: d on the given transgenic organism, give a brief explanation on the alterations of the organism
A: A plant, animal, or microorganism whose genetic material changed using technology that generally inv...
Q: I am a gram-negative bacteria, only a chemoheterotroph, a pathogen and spiral shaped. What am I? Gro...
A: Chemoheterotrophs are bacteria that get their energy from organic chemical molecules and get their c...
Q: Peptidoglycan is composed of: Strands of repeating subunits of G and M with a short stem peptide lin...
A: Given: Bacterial cell wall is made up of Peptidoglycan.Bacterial cell wall provides structure and sh...
Q: 5. In garden peas, gray seed color (G) is dominant to green (g). The following data were collected. ...
A: Trait is a unique characteristic exhibited by an individual . In garden pea , there are two types of...
Q: Given that primates are so well adapted to their environments, why are so many of them endangered? W...
A: Primates are mammals with certain features such as flexible hands and the presence of five digits in...
Q: The followings list the false statements about microbial growth curves EXCEPT Log phase indicates th...
A: Option (b)microbes grow exponentially when they are in the stationary phase.
Q: 2. DNA → AGA ACA TAA ATG CTC TTA ACA CTC ATC AGA CCA GCA CTC CGA TGA MRNA > tRNA → protein >
A: During transcription, the DNA of a gene serves as a template for complementary base-pairing, and an ...
Q: Which of the following make up the vascular tissue found in ferns, gymnosperms, and angiosperms? (se...
A: Vascular plants are seeded plants that contain roots, stems, leaves, and vascular bundles.
Q: Question 29 Which of these is a correct statement about bacterial transformation? O Bacteria can tak...
A: Introduction :- DNA that isn't protected by lipids, proteins, or any other molecule is referred to a...
Q: Determine the host and location of the following: A. Entamoeba hartmanni B. Entamoeba coli C. Entamo...
A: Different varieties of amoeba are found in different habitats. Out of these some varieties are path...
Q: Describe the Theory of Endosymbiosis.
A: a)Endosymbiotic theory states that some of the organelles in eukaryotic cell are derived from free l...
Q: Name 3 organs system in the human body??
A: All living bodies-plants, animals or microscopic organisms, are made up of cells. The term 'cell' is...
Q: what is the difference between the patient's peripheral DNA, the patient's breast tumor DNA, and the...
A: DNA methylation is associated with cancer development and progression. There are several types of sp...
Q: While many of us have an intuitive sense of the what is meant by “growth” in our everyday vocabulary...
A: Introduction :- Growth is the unstoppable growth in the size of an organism through time. It can als...
Q: What is a benefit of bilateral symmetry? Group of answer choices Sensory organs are concentrated t...
A: Radial, bilateral, and asymmetrical symmetry are the three forms of bodily symmetry. So when physica...
Q: Which of the following does not apply to banding patterns in chromosomes O a. are unique O b. are pr...
A: After staining with a dye, chromosomal banding is defined as alternating bright and dark patches all...
Q: Which of the following terms are used to apply ONLY TO SELECTION, and never to just evolution. Choos...
A: the cost or benefit according to natural selection is outweighed by the benefit of sexual selection....
Q: If one person with the trait of Huntington's disease (H h) has 2 children with a partner who does no...
A: INTRODUCTION Huntington's disease It is an inheritable disease in which nerve cells in the brain bre...
Q: What protein does the P53 code for and why is it important?
A: Answer :- The TP53 quality gives guidelines to making a protein called growth protein p53 (or p53). ...
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is...
A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the...
Q: Several members of the family in the pedigree who suffered from a disease are colored in black. Curr...
A: As per the pedigree shown this disease has x-linked recessive mode of inheritance. This is based on ...
Q: Q1 By definition all reported human genome assemblies contain the exact same number of nucleotides. ...
A: Sequencing of full human genome concluded in 2003. This provided information about the genetic makeu...
Q: 2. In tomatoes, 2 pairs of genes affect the phenotypes of ripe fruit with the following alleles. R= ...
A: Phenotypic ratio: Gene expression in future generations of organisms can be predicted using the phe...
Q: In tomatoes, red fruit is dominant over yellow, two-loculed fruit is dominant over many-loculed frui...
A: There are different types of crosses that can be observed in nature. One the crosses is monohybrid c...
Q: explain why spherocytes and sickle cells will decrease the ESR. Your answer
A: The fluid in the body that delivers oxygen and nutrients to the cells, as well as removes metabolic ...
Q: Explain the types of retrotransposons ?
A: Type of genetic component which copy and paste themselves into different genomic location by the pro...
Q: Animal Cell DNA Bacterial cell Plasmid Bacterial 1 3 5 chromosome Questions: 1. Why are plasmids use...
A: Introduction The technique of combining DNA molecules from two separate sources and putting them int...
Q: What is Type II schizophrenia ?
A: Schizophrenia is a mental disorder where an individual has mental inabilities which affects a person...
Q: A question that puzzled scientists was that how chemical carcinogens caused cancer. The experiment g...
A: This is a hybridoma technology where a cancerous cell mixed up with a normal myoloma cell and produc...
Q: Compare DNA transposons and retrotransposons. What propertiesdo they share?
A: A transposable element (TE, transposon, or jumping gene) is a DNA sequence that may move about withi...
Q: What would the sequence of the immature mRNA be? Place the sequence of ALL the transcript that would...
A: Some genes do not synthesize protein by utilising the entire DNA sequence. Introns are non-coding se...
Q: Write the advantages and disadvantages of applying such application in the DNA of an organism. 5. D...
A: DNA manipulation of certain species to produce organs for harvesting. Advantages There will be unli...
Q: Compare and Contrast Synthetic Theory with: a. Lamarckian Theory b. Darwinian Theory c. De Vries The...
A: Lamarckism, a hypothesis of advancement in light of the rule that actual changes in life forms durin...
Q: Consider this chemical equation: Catalase 2H,02 2H,0 + O2 Hydrogen Water Oxygen peroxide What is the...
A: Answer : Catalase
Q: What processes are regulated and controlled or affected by the central dogma and why must these proc...
A: The term central dogma is associated with explaining several processes occurring in the human body t...
Q: 3. A woman has a rare abnormality of the eyelids called ptosis, which makes it impossible for her to...
A: INTRODUCTION Answers of question number three is given below.
Step by step
Solved in 2 steps with 2 images
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
- Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the requested format of your answers. Do not consider any RNA or protein processing events in your answers. transcription terminates promoter (transcription initiates here) 3'-TACATGGAGGGTCGTACTAATTATGGATCTAGTTATCATGTA - 5' 5' - ATGTACCTCCCAGCATGATTAATACCTAGATCAATAGTACAT-3' 2 1. The type your answer... I strand will be used as the template for transcription. (enter only top or bottom; any deviation from this answers will receive no credit. The sequence of the RNA encoded by the gene is type your answer... Type in only the nucleotide sequence of the RNA in the 5' to 3' direction (do not label the ends or add any punctuation marks or spaces). The sequence of the protein encoded by the gene is type your answer... Type the protein sequence using the single-letter amino acid abbreviations from its N to C terminus. Do not label the ends or add any spaces or punctuation marks! #♡ 3 4 % 5 here ↓ < 6…The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThe coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAA
- The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'The following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNA