The polypeptide chains in insulin are held together by hydrogen bonds Group of answer choices True False
Q: 4. Liver alcohol dehydrogenase (LADH) catalyzes a reversible, pH-dependent oxidation of an alcohol…
A: Density=massvolumeDensity of methanol=mass of methanolvolume of methanol0.79 g/ml=mass of…
Q: List the key challenges in the biosynthesis phosphatidylcholine.
A: The most common PL identified in circulating VLDL is phosphatidylcholine (PC) . PC is produced in…
Q: 4. The enzyme abundantly distributed in adipocytes and germinating seeds are A. proteases B. lipase…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…
A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells…
Q: In a 25 uL reaction, you desire a buffer concentration of 1X. You will be supplied with a stock…
A: Dilution of buffer solution or any solution can be done to obtain a diluted solution with varied…
Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas…
A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to…
Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À…
A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate…
Q: Question 17 In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form…
A: Glucometer is the instrument used to measure and display the amount of glucose level in the blood.…
Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids…
A: Hi! Since you have posted multiple question, we shall answer the first question for as we are only…
Q: GLUCONEOGENESIS Reactant Coenzyme/ Product Cofactor Enzymes
A: The balance between the rate of glucose leaving and entering the blood circulation…
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…
Q: When comparing two or more ligands, a larger numerical value for KD corresponds to a higher binding…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Why aren’t your cells poisoned to death even though they create toxins like hydrogen peroxide?
A: The hydrogen peroxide formed produced during normal cellular metabolism. It is a potent toxin that…
Q: Indicate a positive result with a (+) sign, and a (-) if otherwise. A triple (+) may be used to…
A: Molisch’s test - is used to detect carbohydrates. Molisch test gives positive for all carbohydrates…
Q: ideroblastic anemia is observed in the deficiency of which of the following? * (Please choose one…
A: Vitamins are the organic compounds required for the proper functioning of the body. The vitamins are…
Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is…
A: A reduction in muscle force generated over time or as a result of pathological conditions is…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: As given in the question, the concentration of each reactant, i.e., Pyruvate and NADH, and products,…
Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…
A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…
Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for…
A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: fat excess from the liver) in initial stages of liver cirrhosis, toxic liver lesions, and chronic…
A: Since, you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: What amino acid residues interact with methylphenidate in DAT and NET protein active sites? please…
A: DAT and NET proteins are Dopamine Transporter and NET is Nor-Epinephrine Transporter proteins, both…
Q: 3. When the cellular energy charge is high the cells diverts into fatty acid synthesis. A. pyruvate.…
A: Glucose is the primary source of energy for the body. Glucose is metabolized through the glycolytic…
Q: Functional group as indicated by letters A,B,C and D?
A: Tamiflu is a drug made from the starting molecule shikimic acid. Tamiflu is a prodrug usually used…
Q: 6. The synthesis of fatty acids depends on the sequential transfer of three carbon malonyl-groups…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Please discuss how digitoxin provides a positive inotropic effect and is used to treat congestive…
A: Digitoxin is a cardiac glycoside that is used in the treatment of heart failure. Glycoside are…
Q: What are the biochemical test used to assay fatty acids and cholesterol?
A: Fatty acids are carboxylic acid derivative of aliphatic chain hydrocarbon. It can have long or short…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
Q: Which of the following are proper disinfection steps? Check all the O Remove organic matter O…
A: Introduction: Disinfection is substances that are applied to non-living objects to destroy…
Q: Given ohationg im which is a Jlist of orgamelles ņ mitochondira, endopla smic rediculerm,pesoxisomes…
A: A cell is composed of a cell membrane, cytoplasm, and cellular organelles in the cytoplasm.…
Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: Ion exchange chromatography is used to separate molecules based on their net surface charge.
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: Draw two diagrams, one showing what enzymes and products are produced when GLN is high and one when…
A: Gln in question stand for Glutamine. Glutamine is an amino-acid exist in L-form like other amino…
Q: Increased levels of NADH in the liver promote the process of gluconeogenesis. What do you make of…
A: Introduction: The process of synthesis of glucose or glycogen from non-carbohydrate sources in the…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that (A RNA can contain modified…
A: When transcription of DNA to RNA happens the introns are removed either by the RNA itself or by a…
Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…
A: Glycerol : It has 3 hydroxyl groups that get esterified with 1,2 or 3 fatty acids giving…
Q: Choose the wrong statement: Select one: O a. Energy can be converted from one form to another. O b.…
A: ATP (adenosine triphosphate) is a molecule that provides energy to drive many processes in the cell,…
Q: Question 12 C17H29COOH O linolenic acid O non-saponifiable O w-3 fatty acid O All are correct
A: C17H29COOH - It has double bonds at 9, 12, 15th carbon position
Q: How many molecules of NADH are produced if 12 molecules of glucose enter the glycolytic pathway?
A: Glycolysis is a catabolic process which occurs in cytosol.
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: Here, four statements are given based on osmotic pressure and we have to find out the correct…
Q: All are factors or subunits contained within the E. coli RNA polymerase holoenzyme in prokaryotic…
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: ng glycolysis, t
A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If…
Q: Only one of the statements below is correct; which one? O Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: Why in infants idiopathic hypercalcemia occurs?
A: Hypercalcemia is a condition in which there occurs excess calcium in the serum of affected person.…
Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…
A: The genetic material in most organism is double stranded DNA with the two strands running in…
Q: THE TADLE DY REFERRING T OTHE STEP Name of Reaction Reactant Enzyme Product Phosphorylation Glucose…
A: Glycolysis is the catabolic pathway in which Glucose is broken down into 2 molecules of 3C…
Q: Calculate the values of the
A: Enzyme kinetics is a study of the rate of enzyme catalyzed reactions. In Michaelis-Menten kinetics,…
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Dominant allele of a gene expresses phenotype even if it present in single copy. So dominant…
Q: What are the general characteristics of the primary, secondary, tertiary, and quaternary structure…
A: Proteins are unbranched polymers constructed from 22 standard amino acid. They have four levels of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Suggest a reason why trans fatty acids have melting points similar to analogous saturated fatty acids.The formation of thymidylate is typically coupled with the synthesis of which amino acid? O Cysteine Glutamate Alanine Serine O Glycine O GlutamineAll the following amino acids are formed from 3-phosphoglycerate except Group of answer choices Glycine Cysteine Threonine Serine
- C17H29COOH linolenic acid non-saponifiable ω-3 fatty acid All are correctLefer to the figure showing the molecular structure of dimethylmercury. H–C-Hg C-H H. Exposure of human skin to a single drop of dimethylmercury can lead to death, as it is highly poisonous and passes easily cell membranes. Based on its structure, why is it able to pass so easily through cell membranes? I-0-I IICIHWhy double bonds of fatty acids in our body are generally in cis for?
- cip sequence rule in ephedrineThe diversity of functional groups on sugars that can form glycosidicbonds greatly increases the information content of glycans relative to oligopeptides. Consider three amino acids, A, B, and C. How many tripeptides can be formed from one molecule of each amino acid? Now considerthree sugars—glucose, glucuronic acid, and N-acetylglucosamine. Use shorthand (e.g., Glcα(1 → 4)GlcUAβ(1 → 4)GlcNAc to represent 10 trisaccharides with the sequence Glc-GlcUA-GluNAc. Is your list exhaustive?The human body uses the branched polymer glycogen for short term storage of glucose in the liver. It is broken down by the stepwise removal of the terminal glucose monomer. Explain why it is an advantage for glycogen to have a branch chain structure rather than a linear structure. (A pargraph would be great)
- Only do the following- synthesize a monoglyceride and diglycerides and attach them below. Make sure to identify which is which!The following sattements are true for glycogen. EXCEPT: Branching of α(1→6) linkages every 8-12 residues Structure is branched but not as highly as amylopectin of starch Glycogen is stored energy for animals Like amylopectin, glycogen gives a red-violet color with iodineDetermine whether each of the amino acids is polar, nonpolar, positively charged, or negatively charged at pH 7. Polar and neutral aspartate H Ser H₂N-C-CH₂-C-COO NH3 lysine Leu Nonpolar Answer Bank H OOC-CH₂-CH₂-C-COO NH3 Positively charged H CH₂-C-COO NH3 hydrophobic amino acids Negatively charged