The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers. Origin 3' 5' 5' 3' Unwindirg Unwinding Origin
Q: DNA polymerases have a shape resembling a right hand with three functional domains. What are the…
A: The enzyme DNA polymerase is in charge of DNA replication. This enzyme's purpose is to split a…
Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…
A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…
Q: Match Column A (Description) with Column B (protein/enzyme)
A: One new strand (the leading strand) is created as a continuous segment during DNA replication. The…
Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) origin of…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and…
A: A pairs with T with2 hydrogen bonds and C pairs with G with 3 hydrogen bonds.
Q: In DNA replication, what is the primer composed of and whyare there leading and lagging strands?
A: DNA replication is a biological process that results in formation of exact copies of DNA which is…
Q: Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer…
A: Replication is the synthesis of new DNA molecules from the parental DNA.
Q: Does replication occur in one direction or both directions along the parental (old) strand?
A: DNA replication is the biological process of producing identical replicas of DNA from the parental…
Q: What mechanism was originally proposed as one of the three models for DNA replication? What is the…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Which of the following statements BEST describes the process of DNA Replication? Group of answer…
A: To answer this question, each option is analysed as follows and final conclusion is drawn in step 2.…
Q: Describe the early models of DNA replication that were investigated and explain how research by…
A: For DNA replication, three models were proposed: conservative, semi-conservative, and dispersive.…
Q: outline 4 differences between the leading and lagging strand of DNA replication
A: Leading strand. 1.It is a replicated strand of DNA which grows continuously without any gap 2. It…
Q: Using recycled papers and sticks, demonstrate the steps of DNA replication. Use the following…
A: During replication, a double-stranded DNA molecule is duplicated to produce two identical DNA…
Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…
A: Okazaki fragments are short stretches of DNA on the lagging strand, which are synthesized in the…
Q: Match the enzymes involved in DNA replication with their function. Primase [ Choose ] [ Choose]…
A: DNA replication is a process by which a new strand of DNA is synthesized using the existing DNA…
Q: is DNA replication called semiconservative? A. Both daughter strands are entirely new B. Each…
A: Replication of DNA is very important for the transmission of chromosomal DNA from one generation to…
Q: Suppose that 28% of the nucleotides in a DNA molecule are deoxythymidine 5′- monophosphate, and that…
A: DNA is a double stranded helical polynucleotide. It usually consists of two helices, sequences of…
Q: Explain the function of an origin of replication in the replication of DNA, and know how the…
A: Answer :- The beginning of replication likewise decides the plasmid's similarity: its capacity to…
Q: 2) Replicating structures in DNA can be observed in the electron microscope. Regions being…
A: Replication fork It is defined as the structure formed in the long helical DNA during the process of…
Q: With regard to DNA replication, define the term bidirectional replication.
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: Shown below is a hypothetical replication bubble. In what direction does the new strand that uses…
A: In the given image, we are shown the process of DNA replication in which new strands are synthesized…
Q: Why are Okazaki fragments formed? A. Okazaki fragments are the result of discontinuous replication…
A: Answer : Option "E" is correct - Okazaki fragments are formed when the 5'-3' complementary strand…
Q: . Draw a replication bubble with both replication forksand label the origin of replication, the…
A: The area where the replication of DNA occurs called replication fork. When double helix is opened…
Q: What is the BEST explanation for why DNA replication is discontinuous at the lagging strand? А. DNA…
A: DNA possesses information for an individual to develop, survive and reproduce. The hetero catalytic…
Q: Determine what amino acid will be formed from the given DNA strand below:…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: What is the function of DNA primase in DNA replication? O to insert new bases during elongation,…
A: DNA is a molecule made up of a chain of identical five-carbon sugars (polymers) that are linked…
Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: During DNA replication, the function of RNA primers is to Group of answer choices serve as a…
A: DNA replication is the process by which two copies of DNA is produced from a parent DNA molecule. It…
Q: With illustrative diagrams, explain the three theories of DNA replication.
A: The DNA replication is the process of formation of DNA in which one strand of DNA act as the…
Q: Explain briefly how the double-helical structure of DNA suggests a mechanism for DNA replication?
A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…
Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…
A: During replication forks, Okazaki fragments are transient components of lagging strand DNA…
Q: On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’…
A: DNA replication is a complex process of producing copies of the entire chromosome using the…
Q: Why does DNA have a leading strand and a lagging strand during replication? Select the correct row…
A: Replication is the process of copying the DNA strands. It occurs through a series of events with…
Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…
A: DNA Replication Replication of DNA is a process of duplication of DNA, carried out by DNA…
Q: Which of the following statements are TRUE? I. DNA replication is a semiconservative process…
A: INTRODUCTION DNA Deoxyribonucleic Acid, is the genetic material shows a semiconservative mode of…
Q: To which end (5′ or 3′) of a newly synthesized strand of DNAdoes DNA polymerase add a nucleotide?
A: DNA (Deoxyribonucleic acid) replication is the coping of the double-stranded DNA to produce 2…
Q: Describe DNA replication. What are Okazaki fragments? Why does each chromosome have thousands of…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands…
A: Chromosomes are carrier of deoxyribonucleic acid (DNA). DNA is the genetic material. Each species…
Q: Molecules involved in DNA replication A. DNA Polymerase I B. DNA Polymerase II C. Single strand…
A: DNA replication is the process that involves formation of new daughter DNA strand based upon the…
Q: The speed of DNA replication at a replication fork is about 100 nucleotides per second in human…
A: Introduction :- The process by which the genome's DNA is copied in cells is known as DNA…
Q: The DNA double helix looks like a twisted ladder. What makes up each rung of the ladder, what holds…
A: Deoxyribonucleic acid (DNA) is genetic material that contains thousands of genes (unit of…
Q: What factors promote the fidelity of replication during the synthesis of the leading strand of DNA?…
A: Factors which promote the fidelity of replication are DNA polymerase enzyme ,mismatch repair system…
Q: Suppose a future scientist explores a distant planet and discovers a novel form of double-stranded…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: Identify two important enzymes involved in replication. Where does replication occur in the cell?…
A: As there are many questions given in one, the solution is provided only to the first three…
Q: Synthesis of which strand requires the repeated action of DNA ligase?
A: DNA replication is a biological process that involves producing two identical DNA replicas from a…
Q: The following diagram represents a DAN molecule that is undergoing replication. Draw in the strands…
A: The replication of DNA in eukaryotic cells is interrupted. DNA polymerase produces DNA in the 5' to…
Q: If a DNA molecule with the following sequence of bases undergo replication, what would be the first…
A: Hi, Thanks For Your Question. Answer : If the sequence of bases in one strand of DNA is…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.(i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA’s X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W’ AАТСССААТСССААТСССАА-Х" (b) Telomeric DNA Figure 1
- A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.1 10 5' АGT ССG A UGC 3' 8. There are inaccuracies in the DNA molecule shown here. || | | | | |||| 5 тCА GGCT АТG 3' a) Name three things that are wrong in the above DNA sequence. b) What type of chemical interaction is indicated by a "|" in the diagram? c) What happens to these interactions during DNA replication?
- Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) origin of replication, (b) polarity (5′ and 3′ ends) of all template strands and newly synthesized strands, (c) leading and lagging strands, (d) Okazaki fragments, and (e) locations of primers.(d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I II5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
- b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic genome. 5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'