The first base shown in this chromatogram is closest to to : : : : 71 MW Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a the 5'end of DNA b. the 3'end of DNA aSave
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…
A: The double standard DNA molecule is produced by the action of DNA volume range and the process…
Q: If a double stranded DNA has 30 percent of cytosine, calculate the percentage of adenine in DNA
A: Introduction: DNA, or deoxyribonucleic acid, is the hereditary material in humans and nearly all…
Q: In 1950, using “blender” experiment, Hershey and Chase demonstrated that DNA, not protein, is the…
A: Hershey and Chase came to the conclusion that the genetic substance was DNA rather than protein.
Q: Sort the size (bp) of DNA fragments on this gel from small to large. 1 smallest and 4 = largest. B
A: Electrophoresis is the method in which the dispersed particles show motion that is related to the…
Q: In figure 10.16 , how would the curve appear if the GC content of the DNA sample were increased? How…
A: Introduction: DNA is made of four nucleotide bases that are adenine (A), thymine (T), guanine (G),…
Q: According to Chargaff's observations of nucleotide composition of DNA samples OA % of (G + C) + % of…
A: Chargaff's rule has been stated for the DNA, which states that the ratio of purine and pyrimidine…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your…
A: Hi! As you have posted multiple questions, I will be answering the first and third question for you.…
Q: Refer to the attached DNA model. In the spaces provided on the attached table, identify the…
A: DNA or deoxyribonucleic acid is the genetic material present in most organisms. It is composed of…
Q: A plot showing the % of denaturation as a function of temperature for a melting point of a DNA…
A: DNA is a double stranded helically wound macromolecule. Each strand is made up of a sequence of…
Q: DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by gel electrophoresis.…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: What allows the peaks to be different colors?
A: DNA sequencing refers to the determination of the nucleotide sequence in the DNA molecule. Automated…
Q: You extract DNA from 200 milligram of wheat germ. Your total volume of DNA extraction sample is 500…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: The diagram shown below represents an incomplete section of a DNA molecule. The boxes represent…
A: DNA is a double helical structure that is composed of nucleotides. Each nucleotide consists of a…
Q: Based on what we did in lab, if you have an OD260 reading of 0.006 for a sample of DNA. What would…
A: There are several ways to quantitate solutions of nucleic acids. If the solution is pure, one can…
Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…
A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…
Q: DNA strands that can form a double helix are said to be Select an answer and submit. For keyboard…
A: Deoxyribose Nucleic Acid or DNA is a double-stranded molecule with the shape of a twisted ladder.
Q: suppose there are three tubes containing DNA RNA and protein samples in THE laboratory. the three…
A: Introduction: Those biomolecules that require in large amount to keep the body fit and healthy are…
Q: Put the following pieces of DNA in order that they would appear reading from the top (nearest the…
A: First of all lets convert all of them into single unit 1kb = 1000bp So, 21000bp =21kb 10000bp = 10kb…
Q: Draw the following segment of DNA molecule. Show the important covalent and non-covalent…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: listed below, match each to the correct definition. Definition a. Unwinds DNA b. Relieves tension in…
A: All these enzymes help and DNA replication. DNA replication process in which exact similar…
Q: Four nucleic-acid samples are analyzed to determine the percentages of nucleotides they contain.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: . In analyzing the number of different bases in a DNAsample, which result would be consistent with…
A: The DNA (Deoxyribonucleic acid) comprises two types of nitrogenous bases including the purines and…
Q: Calculate the concentration of DNA in your purified sample and determine the mass of the purified…
A: More details are needed to determine the mass of purified DNA. So here we providing you the…
Q: If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…
A: The bacterium Escherichia coli, commonly known as E. coli belongs to the family of gram negative…
Q: The "D" in DNA stands for which of the following?
A: DNA : Chemical name for molecule which carries genetic instructions in the living organisms.
Q: Draw the following segment of DNA molecule. Show the important covalent and non-covalent…
A: Covalent bond is formed by sharing of electrons between adjacent atoms. For example, bond formed…
Q: In a lab question, a student got a DNA solution that has a concentration of 243 ng/uL. The question…
A: Deoxyribonucleic acid (DNA) is the genetic material. It is polymer of nucleotides. Concentration is…
Q: A linear piece of DNA is cut as follows: cut with Ecorl - get 1kb and 4 kb band Cut with Bamhl - get…
A: Ans- According to question For linear DNA – Upon Cutting by for Eco R1 it formed – 1kb and 4kb =…
Q: A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in…
A: Nucleic acids consists of the genetic material which is found in all living organisms. The two most…
Q: A student was analyzing the base composition of a DNA sample, but has lost all the data except the…
A: DNA nucleotide base structure: Each individual unit of the DNA nucleotides is made up of a…
Q: Which of the following items do not affect the melting temperature of DNA? A length of the DNA B the…
A: Melting temperature ( Tm): half of DNA gets denatured (melts). Tm = 2* (A+T) + 4* (G+C)
Q: of the following DNA models is accurately labeled? a. b. A d. 3'
A: The molecule found inside cells that holds the genetic information necessary for an organism's…
Q: A circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA…
A: Linking number is the topological property of . Linking number is a total of twists and writhes. The…
Q: What is a DNA Ladder?
A: Answer :: 1) DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms.…
Q: Why evenly spaced sequence in chromatogram is an indication of a good DNA chromatogram?
A: The characteristics of an evenly spaced sequence are:- Evenly-spaced peak, each being…
Q: Place the following stages of a physical mapping study in theirmost logical order:A. Clone large…
A: Artificial chromosome- laboratory constructed cloning vectors that carry larger DNA insert than…
Q: If a DNA molecule has 33 % G, calculate the percentages of A, T, and C. Type the numerical value of…
A: DNA has 4 bases A,T,G and C Together they make up 100% bases in DNA.
Q: Use Chargaffs Rule to determine the percentage of base T in a sample of DNA that is 28% A and 22% C.…
A: Chargaff observations on the base pairs lead to some rules that help calculate the percentage of…
Q: You are given the following sense DNA sequence:…
A: Solution According to chargaff rule In DNA the Pyrimidine Thymine (T) always pairs with the Purine…
Q: Which of the following is not required for Sanger sequencing of DNA? OA. ddNTPs B. DNTPS C. A DNA…
A: Sanger sequencing is a method of DNA sequencing.It involves selective incorporation of chain…
Q: In this gel, if lane two is DNA from the crime scene, which lane contains DNA from a suspect…
A: DNA fingerprinting method used to find the relationship between the suspect and criminal in the…
Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…
A: Genomic DNA and plasmid DNA are isolated using silica resin columns than using traditional…
Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…
A: DNA is a double-helix structure that is made up of two intertwined polynucleotide strands that are a…
Q: 3' 5' a 5' 3' C f 5' 3' 3' 5' What enzyme should be at location "c" to synthesize DNA after the…
A: DNA replication is the process by which cell makes new copies of the DNA molecule.
Q: hy is there a difference between how the DNA looks between a whole food sample (strawberry or peas)…
A: Genes can be found in any food, whether it comes from plants or animals. The majority of the DNA in…
Q: A DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine,…
A: Genome is not a static entity. It is dynamic in nature. It is subject to different types of…
Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…
A: High quality DNA means that A260/A280 ratio is between 1.8 to 2 whereas a ratio closer to 1.8 is…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which of the ff is incorrect?An AGE run was set at 100V for 30 min. The 3 ul of the ladder was loaded into the gel, while 10 ul of the DNA samples plus an appropriate amount of 6x loading buffer were added into the gel. Find the amount of the 6x loading buffer added to 10 ul DNA samples in order to make the samples sink in the gel? Tip. From 6x final conc of the loading buffer should be 1x and answer shoud be in ulAn AGE run was set at 100V for 30 min. The 3 ul of the ladder was loaded into the gel, while 10 ul of the DNA samples plus an appropriate amount of 6x loading buffer were added into the gel. Find the amount of the 6x loading buffer added to 10 ul DNA samples in order to make the samples sink in the gel? Tip. From 6x final conc should be 1x and answer shoud be in ul
- if you have the following sequence of DNA 5' ATTGCGGAGCCTCGAT 3' do the following:61 identify the primer 3' 5' a 5' 3' C e f a 5' 3' 3' 5' Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a a b b e f a Save Unansweredwol for Frayon Elolog - Meet - cha-gX-m sc Jupiter Ed G Which orgerell= A sample of DNA is collected from an organism. It is analyzed and determined that 20% of the DNA is made up of the base adenine. Based on this information, which of the following correctly lists the amounts of the three. remaining bases for this sample? 10% cytosine, 30% thymine, 40% guanine O 20% cytosine, 20% thymine, 20% guanine 30% cytosine, 30% thymine, 20% guanine 30% cytosine, 20% thymine, 30% guanine p. 5 of 31
- Chromosomal ____________include those that removeor add base pairs (deletions and duplications), and thosethat relocate DNA regions (inversions and translocations).Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'
- Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. Analyse this DNA fragment and answer the questions 1-5 that follow. +1 -10 -35 3' TTGCATCCGAAACGTACGATCGATESGCCGACTTATTACGATCGGACTACTGCGTCGTAGC5' 5' AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATCACGCAGCATCG3' ... ... Provide a brief statement in the space provided 1. What is the name if the TATTA sequence at -10 ? 2. What is the purpose of the -10 and -35 sites 3. What do you understand by the +1 site 4. Write the letters for the bases of the first 6 nucleotides of the mRNA molecule transcribed from this gene. Indicate the 5' and 3' end in your answerAs helicase unwinds the DNA molecule, the separated strands are Topoisomerase kept apart by True FalseGiven: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?