The 1 in the expression * (gPtr + 1) is a(n). A. pointer OB. initializer C. offset D. register
Q: As a computer maker, you should strive to make high-quality machines with fast processing speeds…
A: Introduction: We must create a high-quality, reasonably priced system with sufficient processing…
Q: If we are able to positively identify someone, how much farther can we hope to get? In this part,…
A: Positive emphasizes the need to change your negative outlook to a more optimistic one in order to…
Q: IT has been defined in several ways, but what does it really entail?
A: Information technology:- Information technology (IT) refers to all computer-related tasks performed…
Q: Exactly what are the top four benefits of continuous event simulation?
A: SIMULATION OF CONTINUOUS EVENTS - Continuous event simulation is a kind of simulation in which the…
Q: hat should I write on, given the importance of networking to the evolution of IT?
A: Networking is the practice of connecting computers and other devices together in order to facilitate…
Q: col describes what? Instead of the standard RET at the end of inst
A: Introduction: An interrupt is a signal sent by a computer's internal programme or a device connected…
Q: For this reason, monitoring and planning are often seen as closed systems. How do supervisors go…
A: Tracking and monitoring involves gathering information to check that the intervention is being…
Q: How would you define the term "Interrupt"? Can the lack of foreseen hardware interruptions be…
A: Predicting hardware breakdowns involves characterising their numerous forms. A disc controller or…
Q: Describe the mental image that pops into your head when you hear the word "email." How does an…
A: Email basics: It's a service that sends electronic messages via the internet. It's an efficient,…
Q: why we must go through this authentication procedure. Examine the pluses and minuses of each…
A: Authentication is the process of verifying the identity of a user or device before allowing access…
Q: Graph or Non_Graph in Computer Science E B F A с G H
A: A graph is non-linear data structure which has vast number of real world applications. A graph has…
Q: Identify the vulnerabilities associated with each authentication technique and provide a fix for the…
A: How come mode Organizations in the fields of education, health, and business have been using…
Q: The impact of computer hacking on internet businesses
A: Impact of computer hacking on internet businesses: Computer hacking is the unauthorised use of a…
Q: If a network is to be called functional and efficient, what three elements must it have? There was a…
A: Production planners determine how, when, and where to layout production facilities. To save time,…
Q: In other words, is there any evidence that interrupt-driven operating systems outperform…
A: Interrupt-driven operating systems: The user has a greater degree of control regarding the…
Q: How effective are the Compiler's Phases in completing their major responsibilities? It would be nice…
A: Phases of Compiler's functions Example each phase? Compilation has stages. Each stage has a source…
Q: Each of these three requirements must be met for a network to be regarded successful. A brief…
A: The following requirements need to be satisfied by a computer network: - \securityIt involves…
Q: Give your own words to at least five drawbacks of using the direct technique of solution in…
A: Numerical techniques are used to address engineering issues that may be solved by hand or by…
Q: Since an eight-core CPU only has a single memory channel, multitasking is problematic. So, how do we…
A: A processor is a small integrated circuit in computers and other devices. It accepts input and…
Q: 3. A tree is 4-A binary tree is a rooted tree and every node has at most two children. 5. In a…
A: Dear Student, The answer to your questions are given below -
Q: In the context of computerized information systems used to generate useful data for use in business…
A: Information System: A technical definition of an information system is a group of related parts…
Q: In order to function efficiently and dependably, what are the three characteristics that a network…
A: we are able to deliver performance in microseconds from time to first byte, which is the time from…
Q: Is it true that there are four distinct advantages to using discrete event simulation?
A: Dear Student, The answer to your question is given below -
Q: What's the difference between inserting the value 5 into cell number 6 and simply shifting the…
A: Various stages, such as fetching the opcode, reading and writing to memory, are necessary to carry…
Q: How about a synchronous bus or an asynchronous bus to connect the CPU and the RAM? The…
A: On synchronous buses, the clock ticks and only then are instructions carried out. The rate of clock…
Q: Consider for a minute that you are a software engineer who has invented a system that analyzes…
A: Web applications are lightweight software programmes that enable users to interact with any service.…
Q: Airline companies apply baggage restrictions for their passengers. An airline company has decided to…
A: Below I have provided a program for the given question. Also, I have attached a screenshot of the…
Q: Technology and data allow for the study of issues in information systems.
A: The following topics pertaining to technology and information resources, as well as difficulties in…
Q: Airline companies apply baggage restrictions for their passengers. An airline company has decided to…
A: Below I have provided a program for the given question. Also, I have attached a screenshot of the…
Q: If you have any thoughts on how the software architecture should be reviewed, please share them with…
A: Discuss software structure review using examples. Software Review is a systematic evaluation of the…
Q: To what end do network applications resort to HTTP? Can you tell me what more must be built into a…
A: In this question we need to explain what end do network applications resort to HyperText Transfer…
Q: Is there a certain way to handle several interruptions when doing a System Restore, and what makes…
A: Introduction: the query concerns Since you'd like not have any interruptions when doing a System…
Q: In other words, is there any evidence that interrupt-driven operating systems outperform…
A: Interrupts are signals that are issued to the central processing unit (CPU) by hardware devices in…
Q: The size of the intersection divided by the size of the union is used to determine how similar two…
A: The simplest brute force approach is as straightforward as comparing every array to every other…
Q: Is there a way to determine whether a program is preventing a device from properly transmitting its…
A: Explanation: How can you tell whether an application is influencing the output of a device? You may…
Q: If a network is to be called functional and efficient, what three elements must it have? There was a…
A: Network protocols define how two devices on a network communicate. The specification of network…
Q: A bucket sort algorithm requires that the input is taken from a uniform distribution of numbers and…
A: The solution is given in the below step with explanation
Q: Graph or Non_Graph C A D B F E
A: A graph is a non-linear data structure. A graph has nodes and edges. Many real-world problem are…
Q: Clarify what you mean by "evidence integrit
A: Please check the step 2 for soution
Q: It is known that the inorder sequence of a binary tree is ABCEFGHD; the postorder sequence is…
A: GIVEN INFORMATION:- POST-ORDER = A B F H G E D C IN-ORDER = A B C E F G H D TRAVESRAL OF POST-ORDER:…
Q: Given that central processing units are printed and electricity can't be changed, how can we predict…
A: Energy Transitions: The Central Processing Unit is referred to as the CPU. It might be considered…
Q: In the computer industry, one of the biggest challenges is creating powerful machines that can be…
A: CPU speed, hard disc space, RAM, graphics card, hard disc speed, and defragmenting files if…
Q: In this section, we will look at the four most important Windows settings and why it is so important…
A: An operating system (OS) manages application programmes and is loaded by a boot programme. An API…
Q: In order to function as designed, what are the three most crucial parts of every network? In the…
A: Performance, dependability, and security are essential for optimal network functioning. Number of…
Q: Intelligent modems have the capability to make and end calls as well as answer incoming calls…
A: A answering machine, answering machine or message device, also known as a telephone messaging device…
Q: In order to function efficiently and dependably, what are the three characteristics that a network…
A: The following requirements need to be satisfied by a computer network: - \sSecurityIt involves…
Q: In what respects do you think the following four applications of discrete event simulation are…
A: DISCRETE EVENT SIMULATION: The discrete event simulation is an approach that might be used to depict…
Q: Can you offer any in-depth analysis of the database's file structure?
A: Request: Write a thorough note about the database file system. A database file system is basically a…
Q: When is the TCP three-way handshake most likely to be compromised during the transmission of a video…
A: Given that the TCP three-way handshake is vulnerable in a common scenario involving two computer…
Q: s. Which of the following ways can be used to represent a graph A. Adjacency List and Adjacency…
A: "Since you have asked multiple questions, we will solve first question for you. If you want specific…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- When you move the pointer too quickly, a phenomena known as "submarining" might take place, in which the pointer vanishes.In C language, write a program to input two integers x,y and add both the integers using pointers and display the result in the output. The assignment will be rejected if the numbers are added without the use of pointers.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
- Consider the following pseudo code, Method func() { PRINT “This is recursive function" func() } Method main( { func() } What will happen when the above snippet is executed?use a while loop instead of for loop for this function you are not allowed to use any of the following: dictionaries or dictionary methods try-except break and continue statements recursion map / filterDescribe Operations on Pointer Variables.