Termicin is a small antifungal protein in termites that is produced by cells and secreted into termite saliva in response to a pathogen. In vitro translation of the termicin-encoding gene is performed, and the effects of that product are compared to those of termicin extracted from a termite. You see that extracted termicin exhibits more antifungal behavior than in vitro translated termicin. After further analysis, you see that extracted termicin contains 3 disulfide bonds, while in vitro translated termicin contains zero. The addition of microsomes to the in vitro translation reaction results in termicin with all 3 disulfide bonds. What experimental condition is most likely responsible for this difference? O A. in vitro translation was not performed at the correct temperature affecting protein folding B. a mutation occurred during in vitro translation, leading to differences in disulfide bond formation O.the UPR can not be activated in vitro, therefore, this protein can only be synthesized in cells. D. the absence of microsomes prevented disulfide bond formation and rearrangement due to the absence of protein disulfide isomerase

Termicin is a small antifungal protein in termites that is produced by cells and secreted into termite saliva in response to a pathogen. In vitro translation of the termicin-encoding gene is performed, and the effects of that product are compared to those of termicin extracted from a termite. You see that extracted termicin exhibits more antifungal behavior than in vitro translated termicin. After further analysis, you see that extracted termicin contains 3 disulfide bonds, while in vitro translated termicin contains zero. The addition of microsomes to the in vitro translation reaction results in termicin with all 3 disulfide bonds. What experimental condition is most likely responsible for this difference? O A. in vitro translation was not performed at the correct temperature affecting protein folding B. a mutation occurred during in vitro translation, leading to differences in disulfide bond formation O.the UPR can not be activated in vitro, therefore, this protein can only be synthesized in cells. D. the absence of microsomes prevented disulfide bond formation and rearrangement due to the absence of protein disulfide isomerase

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been associated with many types ofcancers. For this reason, researchers would like to develop drugs toinhibit oncogenic rasH. Based on your understanding of the Rasprotein, what types of drugs might you develop? In other words,what would be the structure of the drugs, and how would theyinhibit Ras protein? How would you test the efficacy of the drugs?What might be some side effects?
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
In the treatment of acquired immunodeficiency syndrome (AIDS), a possible mode of therapy is to inhibit the reverse transcriptase (RT) of the human immunodeficiency virus (HIV), whcih is required for the retrovirus to be propogated by RNA-directed DNA synthesis. In the figure below, one of the substrates for RT is thymidine; and two drugs, AZT and HBY097 are known to inhibit HIV RT> (a) Thymidine; (b) AZT; (c) HBY097 Look at the structures and predict the type of inhibition (i.e. competitive or non-competitive) likely to be shown by each drug. By using knowledge on enzyme, plan an experiment that would enable you to confirm the type of inhibition by investigating enzyme kinetics and explain how you would interpret the results.Remarks: Not more than 250 words.
Some people have a genetic predisposition for developing priondiseases. Examples are described in Table 25.6. In the case ofGerstmann-Straüssler-Scheinker disease, the age of onset istypically 30–50 years, and the duration of the disease (whichleads to death) is about 5 years. Suggest a possible explanationwhy someone can live for a relatively long time withoutsymptoms and then succumb to the disease in a relativelyshort time.
The following statement occurs early in this chapter:“. . . a crucial step in the regulation of many bacterialgenes is the binding of RNA polymerase to DNA atthe promoter.” Why might it be advantageous forbacteria to regulate the expression of their genesat this particular step?
The streptolysin S toxin made by S. pyogenes is encoded by a 9-gene operon, sagABCDEFGHI. Thinking about what a 3-line diagram would look like for this operon, answer the following questions. Write numeric answers only. For example, if your answer is 6 promoters, write only 6. 1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many start codons will be needed for full protein expression? 5) How many mRNA strands will be produced with full operon expression? 6) How many proteins will be produced with full protein expression? 1
Certain mutations called amber in bacteria and viruses result in premature termination of polypeptide chains during translation. Many amber mutationshave been detected at different points along the gene thatcodes for a head protein in phage T4. How might this system be further investigated to demonstrate and support the concept ofcolinearity?
Let’s suppose a researcher was interested in the effects of mutationson the expression of a protein-encoding gene for a proteinthat is 472 amino acids in length. This protein is expressed in leafcells of Arabidopsis thaliana. It has a molecular mass of approximately56,640 Da. Make a drawing that shows the expected resultsof a Western blot using proteins isolated from the leaf cells thatwere obtained from the following plants:Lane 1. A plant homozygous for a nonmutant geneLane 2. A plant homozygous for a deletion that removes the promoterfor this geneLane 3. A heterozygous plant in which one gene is nonmutant andthe other gene has a mutation that introduces an early stop codon atcodon 112Lane 4. A plant homozygous for a mutation that introduces anearly stop codon at codon 112Lane 5. A plant homozygous for a mutation that changes codon108 from a phenylalanine codon into a leucine codon
A newly identified protein from the cells of the Panopyra plant on Pandora was shown to inhibit translation of its target genes by binding to the 5’ UTR of the mRNA and preventing ribosome binding. A possible way this inhibition may be relieved by an sRNA would be: Group of answer choices a)The sRNA acts as a silencer, suppressing the inhibitory protein and allowing translation to take place. b)The sRNA acts as a decoy, sequestering the inhibitory protein and allowing translation to take place. c)The sRNA acts as a marker, flagging the inhibitory protein for ubiquitination and allowing translation to take place.
Arginine is one of the amino acids that serves as a building block for protein synthesis. Arginine biosynthesis depends on the expression of the arg operon, which encodes ArgC (a reductase) and ArgB (acetylglutamate kinase). Which of the following statements regarding mutation of the arginine biosynthesis repressor ArgR is true? O A 1-bp insertion in the argR gene would result in a mutant able to grow in the absence of arginine, O A 1-bp deletion in the argB gene would result in a mutant unable to transcriptionally regulate the arg operon encoding argB. O A 1bp insertion in the argC gene would result in a mutant able to grow in the absence of arginine. O A 1-bp deletion in the argR gene would result in a mutant that represses the arg operon when grown in the presence of arginine. None of the above.
Scientists who study amino acid biosynthesis pathwayswant to isolate auxotrophic bacteria. A technique calledpenicillin enrichment makes this task easier. This procedure starts by exposing a liquid culture of wild-type (prototrophic) bacteria growing in rich (complete)medium to a chemical mutagen. After this treatment,the cells are centrifuged to remove the liquid and themutagen. The pellet of cells at the bottom of the centrifuge tube is now resuspended in medium that lacksone amino acid (in this example, cysteine) but contains penicillin. Subsequently, the bacteria are pouredonto a filter that concentrates them and allows themto be washed free of the penicillin. The living bacteriaretained on the filter are highly enriched for cysteineauxotrophs.a. Given what you know about the action of pencillin,explain why this enrichment occurs.b. Penicillin enrichment is not a selection, becausethe drug does not kill 100% of the prototrophs.The cells on the filter thus need to be screenedfor…
RNAi is currently being tested as a therapeutic tool for genetic diseases and other conditions. Consider the following: cystic fibrosis caused by loss of function of the CFTR gene, HIV infection, and cancer caused by hyperactivity of a growth factor receptor. Which of these may be treatable by RNAi, and which not? Explain your reasoning.