Hi, I need help filling in the table. Activity 2: Set up ligation reaction for Hpall and Mspl-digested samples.You will ligate the sequencing adaptor to the gDNA samples digested with either Mspl or Hpall. Theligated samples will then be amplified using the 20-mer primer.A.5' CGACGTCGACTATCCATGAACAGC 3'3' GTACTTGTCGGC 5'B.5' CCGG 3'3' GGCC 5'5' C3' GGCFigure. 8 Details of the Sequencing Adaptor. A. This double stranded adaptor was prepared byannealing the AdaptorSEQ_FWD and AdaptorSEQ_REV primers. Note the 2bp GC overhang thatis complementary to the GC overhang generated by digestion of the sequence CCGG with Hpall orMspl (right, B)Mspl or Hpall-digested gDNASequencing Adaptor (5μM)Procedure:1. Select 0.2ml (200μl) tubes for the ligation reaction2. Identify the tube with the double-stranded adaptor that is provided at a concentration of 5μM.The ligation is done in a final total volume of 20μl. Calculate the volume that must be addedto the ligation reaction such that the double-stranded adaptor is present at either 0.5 or 1 μMin the final reaction3. The ligation is done with 200ng of Hpall or Mspl-digested DNA. Calculate the volume ofdigested gDNA required for the ligation reaction, and add this to the double-stranded adaptor4. Add the appropriate amount of water to the double-stranded adaptor and Hpall or Mspl-digested DNA as per Table 4Table 4. Ligation of Sequencing adaptor to digested genomic DNAComponentsAmount5. Anneal the double-stranded adaptor and Hpall or Mspl-digested DNA by using a PCRthermocycler to heat the sample to 55°C and then cool it to 22°C over 1 hour6. Add 1μl of DNA ligase and incubate for 60 minutes at 22°C13250ngYou will add adaptor to a finalconcentration of either 0.5 or 1μM -please ask the laboratory supervisor1 X in final reactionVolume (to 20μl)2X Quick ligation bufferWater to a final volume of 19μlBefore adding the DNA ligase, heat the sample to 55°C and cool to 22°C over 1 hourQuick Ligase1μl1μl

Dilution Factor (DF) can be expressed as ratio of volumes and as ratio of concentrations. DF…

Table 4. Ligation of Sequencing adaptor to digested genomic DNA Components Amount Mspl or Hpall-digested gDNA Sequencing Adaptor (5μM) 250ng You will add adaptor to a final concentration of either 0.5 or 1μM - please ask the laboratory supervisor 1 X in final reaction Volume (to 20μl) 2X Quick ligation buffer Water to a final volume of 19μl Before adding the DNA ligase, heat the sample to 55°C and cool to 22°C over 1 hour Quick Ligase 1μl ابرا

Table 4. Ligation of Sequencing adaptor to digested genomic DNA Components Amount Mspl or Hpall-digested gDNA Sequencing Adaptor (5μM) 250ng You will add adaptor to a final concentration of either 0.5 or 1μM - please ask the laboratory supervisor 1 X in final reaction Volume (to 20μl) 2X Quick ligation buffer Water to a final volume of 19μl Before adding the DNA ligase, heat the sample to 55°C and cool to 22°C over 1 hour Quick Ligase 1μl ابرا

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

WACE: Sanger Sequencing Sequencing the DNA of a person who is heterozygous for an allele Sequencing Templates Allele 1 5' CCT GAG GAG 3' www Allele 2 5' CCT GTG GAG 3' 1. What is the Primer location: A or B? 5' CCT GAG GAG 3' wwww sanse A B 2. Draw the bands on the gel corresponding to the sequencing of allele 1. Indicate the 5' and 3’ ends. 3. Draw any additional bands expected if allele 2 is also sequenced. A Sequencing Gel 5' C T G 3'
B 6000 5100 Number of Fragment(s) 4000 100 pX 6000 bp 3000 A A 1500 2000 A B 10. Based on the restriction map of the above plasmid, determine the number of DNA fragment(s) and the size(s) of the fragment(s). Digestion with Enzyme A Enzyme B Enzyme C Enzyme A + B Enzymes A + C Enzyme B+ C Enzyme A + B + C Fragment size(s) in base pairs
Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?
Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?
Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'
Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
You have two sewage samples that you want to check for the SARS Cov 2 viral load. Whichvariable would give you a good estimate?a. High Ct valueb. Low Ct valuec. High melting temperatured. Low melting temperaturee. None of the above The DNA fragments generated during a cycle sequencing reaction are separated by sizes usingcapillary gel electrophoresis. The determination of the actual sequence is based on detection ofa. fluorescently labelled ddNTPsb. the lengths of the fragmentsc. fluorescently labelled probesd. fluorescently labelled primers.
1) Enhanced GFP protein has: An excitation peak at 488nm and emits maximally at 507nm. An excitation peak at 488nm and emits maximally at 587nm An excitation peak at 488nm and emits maximally at 567nm. An excitation peak at 458nm and emits maximally at 507nm. 2) A typical sequencing read will yield _____ nucleotides of unambiguous sequence. 1800-2000 3800-4000 2800-3000 800-1000 3) Sequencing primers should be designed to bind where? ~ 25 nucleotides upstream of the beginning region to be sequenced. ~ 25 nucleotides downstream of the beginning region to be sequenced ~ 60 nucleotides upstream of the beginning region to be sequenced. ~ 60 nucleotides downstream of the beginning region to be sequenced