- Solve the following genetic problems with a Punnett square 1. An organism that shows a dominant trait (purple flowers), is either homozygous or heterozygous for the dominant allele. By performing a test cross, with a homozygous recessive individual the unknown Apts can be determine quares (remember you'll need to test BOTH heterozygous and homozygous)-
Q: (a) Explain the signals (wingless, Hh, Serrate) how they are sent and received (b) what is the…
A: Introduction. Segmentation in drosophila is a spatially and temporally regulated sequential event.…
Q: Are the following primates (same species) exhibiting sexual dimorphism? Explain your reasoning:
A: The characteristics of the organisms are the basis of their classification system. It also gives an…
Q: Compare the amount of ATP used with your dominant hand to the amount in your non-dominant hand.…
A: ATP is the energy currency of the cell, as it is needed for every vital functions performed by the…
Q: All of these are mechanisms of eukaryotic RNA processing except: Group of answer choices The…
A: In eukaryotes, the primary RNA transcript undergoes post transcriptional modifications. These…
Q: 1.What is the official genename of the gene? Do you have another names?
A: The gene is formally represented by the suggested name. However, a particular gene has frequently…
Q: purple kernel color, while the homozygous recessive genotype causes red kernel color. If corn plants…
A: Given :- Dominant allele Z and recessive allele z Dominant allele cause purple colour and the…
Q: What kind of nutrient pool (atmospheric or sedimentary) characterize the following matter:…
A: The nutrient pools of each of the given cycles can be identified as follows- Phosphorus -…
Q: Which of the following pathways is likely to NOT be directly affected by the antimetabolite drug…
A:
Q: List five (5) factors affecting fixation of the cells in a physical and chemical state
A: Fixation: Fixation is a procedure in which cells or tissue are fixed partially in a chemical and…
Q: A dominant gene R and the recessive a causes retinitis pigmentosa, a form of blindness in man. Thus…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: B. Let's assume that a small proportion of the homozygote ss individuals do survive and reproduce,…
A: According to the Hardy-Weinberg equilibrium, if no unfavorable forces exist, genetic variation in a…
Q: What is photosynthetic rate and how do you measure it in leaves?
A: The process by which plants convert carbon dioxide, water, and daylight into oxygen and sugar-based…
Q: PLEASE ONLY ANSWER WHEN ALL THE ITEMS BELOW WILL ALL BE ANSWERED. THANK YOU! From the given…
A: The analysis of phylogenetic tree helps us understanding the patterns of evolution and the…
Q: Examine the figures below. Identify if the primate is nocturnal or diurnal by highlighting or…
A: Diurnal animals are typically active throughout the daytime. Animals that are nocturnal are…
Q: A hemophiliac male puts on Match.com an ad for a ‘Normal’ Homozygous dominant female to mate with.…
A: Haemophilia is an X linked recessive genetic disorder. Let XH - normal X chromosome. Xh -…
Q: Viruses are not found in the tree of life. Why do you think so?
A: A virus is an infectious microorganism made up of a protein-coated segment of nucleic acid (either…
Q: Discuss the major aetiologies, laboratory findings, and pathologic consequences in a patient with…
A: Congenital heart disease represent the various types of birth defects that causes abnormalities of…
Q: Observe the species in your surroundings, take a picture of the leaves of at least three plant…
A: In given question three type of leaves given of Aloe Vera,organo and Banana leaves. Base is bottom…
Q: explain what can be the future developments of curing adenocarcinoma tumours in regard to (colon)…
A: A group of benign (noncancerous) cells collectively known as an adenomatous polyp is the primary…
Q: Liver 1. Explain what it means for bile to emulsify fat ? 2. Where is boiled stored ? 3. What does…
A: The digestive system helps digest food to micronutrients, which are absorbed by the body. And…
Q: 6. What do you see in the structure of cellulose that tells you why "fiber" is listed on nutrition…
A: Ans: Cellulose is the structural component of the plant cell wall and found abundantly in the…
Q: True or false Nociceptors directly detect bacterial pathogens and their products
A: Nociceptors are sensory neurons which are specialized to sense those stimuli which are potentially…
Q: Why is the 16S rRNA gene sequence used in identifying bacteria species
A: Introduction - 16S rRNA gene sequence analysis can better identify poorly described, rarely…
Q: The inside negative membrane potential is a force that helps support... a.) the movement of…
A: *Membrane potential forces ions to move passively in one direction. *positive ions are attracted by…
Q: Match the enzyme on the left with its role in DNA replication DNA polymerase l helicase DNA ligase…
A: DNA replication produces DNA molecule from the parental DNA molecule. It is catalysed by DNA…
Q: Explain the CIN, MSI, CIMP pathways and mechanims in regards to adenocarcinoma colen cancer.
A: Colon and rectal cancers, two extremely aggressive and prevalent kinds of cancer, are included in…
Q: A tRNA has the anti-codon sequence 5' UAC 3. What amino acid do you expect to be attached to this…
A: Translation is a process in which sequence of nucleotides in mRNA is translated into the sequence of…
Q: How can this fusion be done? Can something be done using tissue engineering and 3D printers? What…
A: 3D printing: The process where the biomedical structure in a three-dimensional form can be printed…
Q: What is the multi hit approch/hypothesis to adencinocama colonrecal cancer. explain and analyse the…
A: The multi-hit hypothesis identifies the combination of genes with mutations that may represent the…
Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…
A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…
Q: @ Explain or describe how homeostasis is the mantenance of a dynamic range of environmental…
A: Homeostasis is the process in which the body changes adjusts to the change in the environmental…
Q: What is different about prophase I and prophase II of meiosis?
A: Cell division is the process through which new daughter cells are formed from the parent cells. It…
Q: List 12 ecological impacts for land covers for project Plan River training.
A: RIVER TRAINING- The structural actions done to enhance a river and its banks are referred to as…
Q: Determine the classification of this organism's oxygen requirement, growing under different oxygen…
A: The need for and reaction to ambient oxygen is one of the most obvious variations amongst bacteria…
Q: When a motile cell wants to change the direction of the movement; it remodels the actin under the…
A: The cytoskeleton proteins in the cells are responsible for different functions in the cells. The…
Q: Ⓒ→ [ooo 2 A UGG 3 сл G 1
A: Introduction :- The illustration is denoting the process of translation. After DNA is converted to…
Q: T cells reach the central nervous system by way of- action of membrane pore-forming proteases…
A:
Q: Contain the protein hemoglobin Function in immunity and fighting infections Transport oxygen and…
A: RED BLOOD CELLS- Hemoglobin is a protein found in red blood cells, sometimes referred to as…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: 2. On your drawing of glucose, circle and label the hydroxyl groups. What does the presence of…
A: Carbohydrates are polyhydroxy aldoses, ketoses and their derivatives that yield such compounds and…
Q: Determine if the cells in prophase II of meiosis are haploid or diploid.
A: Mitosis and meiosis are two kinds of cell division that occur to form daughter cells. Mitosis occurs…
Q: Examine the illustration below and answer the following questions: a. Compare fore-limb (arm) length…
A: Please follow step 2 for detailed explanation.
Q: ANCOVA
A: The protective effect of E.farcium on s.typhimurium infection induced damage. This study compares…
Q: estions below all refer to the following pedigree. The locus for allele D/d determines how cilia on…
A: It is evident that the trait is not sex-linked because:- In the case of Y-linked disorders, only…
Q: What is the difference between a postorbital bar and fully enclosed eye sockets? What is a…
A: Ans: Postorbital sockets are going in the all the primates which connects the frontal bone to the…
Q: Enzymes catalyze a chemical reaction by A. decreasing the amount of ATP required to activate a…
A: Enzyme is a protein is a substance. Friedrich Wilhelm Kuhne was the one who coined the term ' Enzyme…
Q: What happens in the cell eventually after signals are transduced?
A: Cells communicate with each other via released proteins unique to each kind. Cell signaling can be…
Q: Determine if prophase of mitosis contains 2 chromatids or only one chromatid.
A: Introduction One cell (the mother) divides into two new cells (the daughters) that are genetically…
Q: Should more weight should be given to genetic data or to information derived from comparative…
A: Genome refers to a complete set of genes in an organism. A taxonomic classification is a scientific…
Q: Using a chart, predict the results of all 4 macromolecule tests for the following substances: egg…
A: Macromolecule are very large molecule . It made up of thousands covalent bonds.
asap please.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- ng -Courses iblic/activ 003004/a s sment al V T-Rex Game. un in to your acc. L 1.3.4 Quiz: Predicting Genetic Outcomes Question 1 of 10 Mendel used over 28,000 pea plants in his experiment. How does this large sample size make his results more reliable? O A. He was not sure which of the plants were female and which were male. B. Most of the plants were unable to reproduce, so he needed many of them. C. He used more plants so the experiment wouldn't take as long. D. It made his actual results approach the results predicted by probability. SUBMIT E PREVIOUSShow Comments Track Changet O Markup OptionS Track Changes wious Next Genetics Lab Exercise (by Dr. Lapik) Question 2. 田 BB = black Analyze the following dihybrid cross: Bb = black Parents: bbLI bb = white LL = short hair U = short hair Gametes: U= long hair Punnett Square: How many of the offspring are: Black, Short Black, Long White, Short White, Long Autupay Credentials Username ENNIN CitrixDrosohpila Punnet Square of Crosses. I need results of F1 & F2 generation using Punnett Squares for: Make Punnet Squares of the following crosses •Drosophila Female wildtype cross Male White-eye •Drosophila Male wildtype cross Female White-eye •Drosophila Female Wild Type cross Male Scarlet Eye •Drosophila Male Wild Type cross Female Scarlet Eye Also, Which allele is heterozygous and which is homozygous, & which is dominant and which is recessive?
- O e. Parent 2: Parent 1: Parent 2: ¡Ai QUESTION 9 Bi QUESTION 8 Let's assume that, in dragons, red scales (B) are dominant to green scales (b), and long tongues (S) are dominant to short tongues (s). The genes that determine these characteristics assort independently. A homozygous red, long-tongued dragon is crossed with a homozygous green, short-tongued dragon. If an F1 dragon is crossed to a homozygous green and homozygous short-tongued dragon, what phenotypes and proportions are expected in the offspring? O a. 100% green and long-tongued O b. ½ green and short-tongued & ½ red and long-tongued O c. ½ red and short-tongued & ½ green and long-tongued O d.% red and long-tongued, % red and short-tongued, ½ green and long-tongued, % green and short-tongued O e. 9/16 red, long-tongued, 3/16 green, long-tongued, 3/16 red, short-tongued, 1/16 green, short-tongued Save and Submit to save and submit. Click Save All Answers to save all answers. 000 MacBook AirSearch Punnett work.docx Close Fle Home Insert Layout В U ニv言 ... 2. In humans, dimples are dominant over no dimples. Make a Punnett square that crosses a heterozygous dimpled person with a homozygous dimpled person and determine the probabilities of all phenotypes and genotypes. of cat that has curly ears. ロDirection: Read and understand the ff. set of monohybrid cross problems and answer each problem by showing the Punnett square, genotypes ans phenotypes. 3. In tomatoes, red fruit (R) is dominant over yellow fruit (r). A plant that is homozygous for red fruit is crossed with a plant that has yellow fruit. What would be the genotypes and phenotypes? 4. If two of the first generation offspring from the problem above were mated, what would be the genotypes and phenotypes of the second generation?
- , Σ. K Q R. click "Turn In" on Google Classroom when you are done. 2. In pea plants, yellow seeds are dominant to green seeds. A heterozygous yellow-seeded pea plant (Yy) is crossed with a plant that has green seeds (yy). Yellow Seeds Y y Phenotype Probability (%) У Yellow Seeds: y Green Seeds: 4. In another one of Mendel's experiments. he crossed the offsprina. Two nea Hide sid US 12 Green Seeds 田Topic: Penetrance. Petal number is controlled by a single gene in merigonias. The gene has a completely dominant wild type allele F that makes a plant have five petals and a mutant recessive six petal allele(f). However the six petal trait is only 50% penetrant. You do the cross Ff x Ff. What fraction of the progeny do you have the 6 petals? what is the meaning for 50% penetrant.t 2. ng. Questions and Problems Given the pedigree below, answer the following questions separately for each pedigree. 1. What is the mode of inheritance? 2 Write the genotype of the individuals in the pedigree based on the mode of inheritance given. date distance Pedigree 1 gous Pedigree 2 Recombination zzel 9rd To ya hisiga of elds ed bittorie 10 Tube heterozygpitanjonosenis the fasiria cell while the tester, taken as the raingoz, mix on the allele of the nie of Deteraniol are now adva Hol Tidmoos DNG sevel. This cross will produce filial generation (2) walthen purple ves f 11020 12 13 encont 000 sg nomi 2 is importan gies to do this, scientists preously 4 méte based monso nomiskt sild devon S01 000 05 1uodo 910 919/3 2m al m 29098 3291T 20 comondo of pes. The value is, the OTO the value is the closer 1 2 nesten che 3 4 5 6 I snag- niboo to 19dmun srid wordt oo Jadigrappen va bo trog do disp ambe 000 61 251110010 aliso ist was by The song Shear Besa STS GRAD color. In his experimenti…
- Is Add-ons Help Last edit was 4 minutes ago -BI A E E- Arial Narrow 14 P. R. In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive flies are crossed. Homozygous Recessive Fly Phenotype Probability (%) Long Wings: Short Wings: In rabbits, black fur (B) is dominant to white fur (b). A purebred (homozygous) 10. Lioak t rdnAloto hed with a omalo that has the recessive white fur %S4 MN 8. Recessive Fly HomozygousG Describe Muller's Ratchet-Googl x nooreps.owschools.com/owsoo/studentAssignment/index?eh=310247513 Asslgnment -6. Mendelian Genetics Attempt 1 of 2 ASSIGNMENTS COURSES SECTION 7 OF 8 « < 4 5 8. 9. 10 11 12 13 14 Click an item in the list or group of pictures at the bottom of the problem and, holding the button down, drag it into correct position in the answer box. Release your mouse button when the item is place. If you change your mind, dra the item to the trashcan. Click the trashcan to clear all your answers. Make a Punnett Square for two smooth seed hybrid pea plants (Ss) Click once to select an item at the bottom of the problem. Click again to drop the item in its correct place. S SS Ss SS SQuestion: The disorder: Red-Green color blindness Explain the mode of inheritance of the disorder (recessive, dominant, x-linked, etc.) . Can a person be a carrier of this disorder? • Describe the probability of having a child with the disorder -- give a specific scenario (ex. both parents are heterozygous for the trait) • Describe the symptoms associated with this disorder Explain the prognosis of a person born with this disorder