Q: How would Oligotrophic lakes can turn into eutrophic lakes ?
A: Oligotrophic lakes are the ones which have very poor nutrient supply and cannot have much aquatic ve...
Q: according to _______ hypothesis a multicellular organism originated from a coenocytic protist with s...
A: The cellularization (syncytial) theory According to cellularization (syncytial) hypothesis a multice...
Q: Which NUMBER(S) indicate NADH production in the overall process? *
A: Ans- In the given question, the figure represent glycolysis cycle. Glycolysis is a series of reactio...
Q: Which of the following is false concerning the carbon cycle?
A: The carbon cycle is a term used to describe the process by which carbon atoms are constantly transpo...
Q: All members of all species in a certain area is a(an) __________. a. ecosystem b. biosphere c. ...
A: All members of all species in a certain area is a(an) population . Population is the all members o...
Q: During the citric acid (Krebs) cycle, the energy from acetyl-CoA is captured in which molecules? CHO...
A: Introduction :- Cellular Respiration is the process of oxidation of glucose ( and other energy sourc...
Q: Please select the word from the list that best fits the definition For some people, an insect sting ...
A: some insect like bees, mosquito bite or sting a person when they come in contact with them. the effe...
Q: Use the following figure to indicate the structure that was found to be mutated in the modern day fr...
A: Introduction :- Stickleback is a species of fishes that belongs to family gasterosteidae and the ord...
Q: What happens to individual Vaccinia viral particles that do not possess the genes necessary to overc...
A: As we know that viruses are simple, noncellular entities consist of either DNA or RNA enclosed in a ...
Q: normal wings (A) are dominant to dumpy wings (a) and the presence of eyes (B) is dominant to the ab...
A:
Q: What type of database is OMIM?
A: OMIM (Online Mendelian Inheritance in Man) is a daily updated catalog of human genes and genetic phe...
Q: Which of the following is not an abiotic factor in an ecosystem? A Available light B) Temperature C)...
A: The ecosystem is a community or area where animals, plants and many other elements or organisms live...
Q: What are the characteristics of mate preference in sexual selection?
A: Mate preferences are basically defined as the results of psychological mechanisms that encourage peo...
Q: why is the otter a keystone species?
A: keystone species which means that they can exert top-down pressure via predation on sea urchins and ...
Q: a.) Food quality related the concepts of: b.) Food safety dictates that:
A: a) The food quality explains the food characteristics which are subjective characteristics and objec...
Q: 1.________ errors may be avoided by ensuring that the tools that are used in the experiment are prop...
A: An 'error' is defined as a deviation from accuracy or correctness. A'mistake' is an error caused by ...
Q: 5 joints to describe in the image. for example her left arm is extended at the shoulder joint.
A:
Q: Given that long wings (L) are dominant to short wings (I), predict the phenotypic ratio in a cross b...
A: Monohybrid cross involves single gene. Because single trait is involved in this case.
Q: charge molecu Some bacterial pathogenic strains have the ability to evade the action does. of antibi...
A: Introduction :- Antibiotics are drugs that are used to treat infections caused by bacteria (bacteria...
Q: 1. Which of the following is the hardest type of coal?
A: Coal is a combustile black or brownish black sedimentary rock. coal is mostly carbon compound with t...
Q: What is the size for cut lane #5 to measure the Sac1? The T-vector size is 3kb, what is the size f...
A: The DNA is loaded into pre-cast wells in the gel and a current is applied in order to separate the D...
Q: What is a transgene
A:
Q: What does the following vector produce? Be specific.
A: Vector is defined as a DNA molecule which is used as a vehicle to carry foreign genetic material int...
Q: The root of all environmental problems on earth today comes from: A The overpopulation of humans Hab...
A: Our surroundings are always changing. It is a reality that cannot be denied. Nevertheless, as our en...
Q: Cranial nerve blank can be found in the abdominal cavity what one can be found in the abdominal ca...
A: According to the question, we have to mention the Cranial nerve which can be found in the abdominal ...
Q: Ear shape and eye color are examples of 1. Genotypes 2. Phenotypes 3. Alleles 4. Recessives
A:
Q: zygous Heterozygous Wild Type Female Wild Type Female Male d symbol denotes an gthe phenotype of int...
A: Hemophilia A is inherited in an X-linked recessive pattern. X-linked recessive inheritance refers to...
Q: Which of the following genomes of our biosphere can mutate rapialy? Select one: а. an Oak tree b. Hu...
A: The rate of mutation depends on the number of times an organism reproduces in a specified time perio...
Q: What will be the blood type of the child if it has the following "homozygous" parents for this parti...
A: Prior to the 20th century, it was thought that all blood was identical. This notion led to frequentl...
Q: Modern humans crossed a landbridge from Asia into North America during a glacial period about 20,000...
A: Hominins are primates that belong to family Hominidae. It includes bonobos, chimpanzees and humans.
Q: Describe the three models for RNAP active-center translocation during transcription initiation?
A: In gene expression. transcription initiation is the first and highly regulated process. In initial s...
Q: Question 23 In fruit flies, eye color is an X-linked trait. Red eyes (XB) are dominant to maroon eye...
A:
Q: question- What causes bacterial vaginosis and what causes it? What is the location of the reservoi...
A: Bacterial vaginosis (BV) is an infection of the vagina. With this their is their is change in the no...
Q: The blank is the only bone that doesn't articulate with any other bone
A: The hyoid bone is the only bone in humans that does not articulate with any other bone,but only has ...
Q: CRISPR/Cas9 mediated genome editing has provided an unparalleled means of manipulating the genome. D...
A: CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR-associated genes) is a...
Q: identify some growth and development variables involved in plant growth
A: The growth and development variables involves in plant growth are - Water Light Temperature Nutriti...
Q: Which of the following is NOT a reason why fungi can grow so quickly? Group of answer choices exte...
A: Fungi are heterotrophs that mostly grow on decaying organic matter. These secrete the digestive enzy...
Q: 11. An autosome is 1. A dominate chromosome 2. A sex chromosome 3. A recessive chromosome 4. Any chr...
A: DNA and RNA are polynucleotides that are composed of a chain of nucleotide monomers with distinct ni...
Q: Create a chromosome map for each set of three genes from the given information. b) the crossover fr...
A: Answers : X and Z = 8.5% Y and Z = 2.25% Y and X = 6.25% The more lesser the percentage between the...
Q: labeled M is the muscle. A
A:
Q: A young Honduran female patient presented with a huge cutaneous ulcer involving the right shoulder. ...
A: Cutaneous(Skin) ulcers are open sores on the skin mainly due to poor blood flow,pressure or any inju...
Q: Record which pole the dyes traveled to by using a (+) for positive and (-) for negative pole. Hint: ...
A: Staining is a technique in which the substances observed are being made visible to the eyes. In gel ...
Q: What is OMIM?
A: Gregor Mendel introduced the concepts of Mendelian inheritance in 1865 and 1866, which were revived ...
Q: 9. Please determine whether the allele responsible for the trait is dominant or recessive. (A) (B) %...
A: Pedigree analysis gives an idea how the disease is transferred from parents generation to next gener...
Q: Cloned human embryonic stem cells would be useful for which of the following reasons: Group of answe...
A: Introduction :- Cloning is a process of making the genetically identical copies of cell / tissue / o...
Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons
A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino aci...
Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu cuaucccaaaaucua...
A: RNA molecules are formed with the help of template DNA strand in the process transcription with the ...
Q: Scientists look at thousands of mutagenized flies, one at a time, under a microscope. They are looki...
A:
Q: If possible can you can explain what’s going in parts/paragraphs base on this slide, it involves cel...
A: Meiosis is the process through which gametes are produced during cell division. We start with a cell...
Q: Describe the structure of the cell wall of a Gram-negative and a Gram-positive bacterium, respective...
A: A cell wall is a structural layer that surrounds some types of cells immediately outside the cell me...
question: 4. in the diagrams below, what type of solution is each cell?
Step by step
Solved in 2 steps