Sketch the UV-Vis spectrum of each pure protein (A, B, C, and D) from 240 - 480 nm if they were all present at 20 µM. Note: I want four clearly labeled spectra on one plot.
Q: 1. Calculate a creatinine clearance and its reference range. 2. Explain the biochemical formation…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: he human body requires various nutrients which are essential for health and can be obtained from a…
A: Proteins are comprised of amino acids polymer linked by peptide/amide bonds. Fats are insoluble…
Q: What is misleading about the term hydrophobic bond? What drives the hydrophobic effect? How is it…
A: Introduction Hydrophilic molecules are water loving groups and are soluble in water. But hydrophobic…
Q: 1. Bacteria have a membrane potential, although the mechanisms of how it is maintained differ from…
A: To calculate the number of positive ions needed on the exterior surface of the bacterium to…
Q: 5. Explain in quantitative terms the circumstances under which the following reaction can proceed in…
A: For a reaction to proceed spontaneously the change in Gibbs free energy (∆G) of the reaction has to…
Q: Explain the localization and mechanism of acetone formation, under what physiological conditions…
A: Acetone is one of the type of ketone bodies formed in the human body. Ketone bodies are formed when…
Q: True or false - metabolism of triglycerides generate water - sphingolipids are formed from glycerol…
A: Fatty Acids belong to one of the major classes of Biomolecules that is Lipids. It is the main…
Q: Question 5 What would occur if the concentrations of GAP and GEF were reversed? (high [GEF] in…
A: Answer; imported cargo proteins would not be released in the nucleoplasm Explanation: If the…
Q: Certain proteins undergo Post Translational Modifications (PTMs) with lipid derivatives such as…
A: Post-translational modification Post-translational modification is a process by which proteins are…
Q: Without "unraveling" the following carbohydrates, classify each as a ketose or aldose HO но- HỒ CH…
A: The classification of a carbohydrate as a ketose or aldose depends on the location of the carbonyl…
Q: 6. Sickle cell anemia is a genetic disease resulting from a single amino acid substitution…
A: The following steps describe the structure of normal and sickle cell hemoglobin and explain the…
Q: Why would LDH be up- or down-regulated depending on location of cancer cells? Anaerobic cancer…
A: Introduction glycolysis is a process by which glucose breaks into pyruvate. Glycolysis occurs both…
Q: You want to maintain pH-7.0 for an enzyme-catalyzed reaction that will produce hydrogen ions along…
A: Here we are undertaking a reaction that will produce hydrogen ions (H+, generally termed as protons)…
Q: a) Draw the 5’-monophosphate-2’-deoxyguanosine nucleotide covalently bonded with neighboring DNA…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: differentiate the intermdeiates in term of theri reaction with lugol's solution and benedict…
A: Starch is the main source of carbohydrates, it is commonly found in nature. The foods like,…
Q: Acetyl-CoA carboxylase is the principal regulation point in the biosynthesis of fatty acids. Some of…
A: Acetyl-CoA carboxylase (EC 6.4.1.2) is a biotin-dependent enzyme. It is responsible for the…
Q: A. hand-draw the chemical structures of dipalmitoyl phosphatidyl choline, DPPC (also known as…
A: Lipids are classified into charged and neutral lipids based on the presence of phosphate group.…
Q: In the Belmont Report, Relate the 3 major Bioethical Principles in the context of Biochemical…
A: The Belmont report puts forth a set of principles and guidelines that should be followed while…
Q: Which type of protein is classified by a polypeptide which is arranged in long strands or sheets?…
A: Each and every live cell has proteins. Protoplasm, cell membranes, and nuclear material all include…
Q: How to control or take care of microbial metabolism?
A: Microbial metabolism is the pathway followed by microorganisms to obtain the energy (carbon source)…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: what is bioenergetics ?
A: The scientific field of biochemistry focuses on all the chemical and biological processes involved…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: The rate of transformation of S, have been determined in the presence of two compounds M and N.…
A: Enzyme Inhibitors are the substances that can bind to enzyme and inhibit the enzyme activity . On…
Q: (ii) Shown below is a section of a canonical TFO. Discuss, in detail, chemical modifications that…
A: Triplex forming oligonucleotides (TFO) are single stranded homopyrimidine/homopurine oligonucleotide…
Q: 4. Below is data obtained for an unknown protein's dihedral angles. Each dot represents the dihedral…
A: The peptide backbone can rotate about 2 bonds. The N-Cα bond that generates the φ angle and the Cα…
Q: 1.b)Which one of the following would produce the most reliable evidence? in vitro study case report…
A: There are several different types of study designs that are used to gather evidence, each with its…
Q: Glucagon facilitates the adaptation of our body to fasting. Which enzymes of glucides…
A: Glucagon is a pancreatic hormone secreted by the alpha cells of the pancreatic islets, composed of…
Q: Some scientists debate whether it is correct to consider pyruvate as “the end of glycolysis”.…
A: Introduction All living organisms require energy. They get energy from cellular respiration.…
Q: Which pathways are utilized in order to allow for glucose from glycogen to be converted to ribose…
A: Glycogen is a storage polysaccharide made up of D-glucose residues. When signalled, the cell can…
Q: Name of Enzyme Class Number of Enzyme Reaction Catalysed Hexokinase Phosphorylates glucose…
A: Glycolysis is a pathway that converts glucose molecules into energy by breaking into pyruvate…
Q: 1.a)Which one of the following is NOT broken down by the amylase enzyme? Amylopectin Starch Sucrose…
A: Enzymes are biological catalyst that speed up biochemical reactions. Enzymes are highly specific in…
Q: Referring to the figure below(first picture) explain photosynthetic electron transport. Then compare…
A: Electron transport in oxygenic photosynthesis is a highly regulated process that involves the…
Q: Draw an approximate titration curve for lysine, given that its pKa(COOH) = 2.18, its pKa(NH3*) =…
A: Amino acid has a typical structure. It has a central Carbon atom called (Cα). To it 4 groups are…
Q: It is a pyrimidine derivative that does not form part of nucleic acids.... A) Thymine B) Cytosine C)…
A: Nucleotides are the building blocks of nucleic acids. They are phosphoric acid esters of…
Q: Consider a peptide with the sequence Ala-Glu-Arg-Leu. Assume the ionizable groups have the pKa…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Bile acids: localization of synthesis, their biochemical significance.
A: Introduction Cholesterol is a compound which is essential for our body. Cholesterol is synthesised…
Q: Why is it important to inhibit the Calvin-Benson-Bassham Cycle to have efficient hydrogen production
A: The Calvin-Benson-Bassham cycle is a biochemical reactions that convert light energy into chemical…
Q: 67. What is the CORRECT terminology for reactions A and B in the diagram? ( (ADP) o- (ATP) 70. Water…
A: There are several types of chemical reactions, including: hydrolysis, condensation, redox,…
Q: 3. Some proteins are membrane bound and have segments (called transmembrane domains) that pass…
A: There are different proteins associated with lipid bilayer and they perform different functions.…
Q: 2. Biosynthesis of cholesterol in the human body: 2.1. cellular and tissue localization of the…
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…
A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…
Q: Formation of cholesterol "fund" in the liver.
A: Cholesterol contains 27 carbon atoms all supplied by acetyl CoA. Cholesterol has 3 six-membered…
Q: Deduce the amino acid sequence of a polypeptide from the following: 1. Acid hydrolysis gives Ala2,…
A: Deducing the amino acid sequence of a polypeptide from the analysis of peptide fragments generated…
Q: As we grow up or old, metabolism gets faster or slower?
A: Metabolism is the process that involves catabolism and anabolism . These are the reactions during…
Q: a. Draw out the pathways described above. Provide accurate line drawings for each lipid described b.…
A:
Q: 1.a)Which one of the following diseases is caused by an iodine deficiency? pellagra goiter night…
A: Iodine deficiency is a condition in which the body does not have enough iodine to produce thyroid…
Q: 3. Tyrosine kinase receptors are pairs of proteins that span the plasma membrane. On the…
A: Enzymes can exhibit cooperativity, which refers to the phenomenon where the binding of a substrate…
Q: 10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12.…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: 1. Amino Acid 1 = W + X = Draw amino acid 1 at a low pH a) As the D Fisher Projection Name of amino…
A: Amino acids are organic compounds that contain an amino group (-NH2) and a carboxylic acid group…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Consider the following properties of the protein components of a sample mixture as provided in the table below: 1. if the mixture is subjected to gel filtration chromotography which protein component elute first? 2. if the mixture is subjected to isoelectric focusing which protein will stop m oving nearest to the positive electrode? 3. if the mixture is subjected to cation-exchange chromotography using a buffer at ph 7 which protein will bind to the resin? 4.if the mixture is subjected to SDS-PAGE which protein will be at bottomost portion of gel? 5.if the mixture is subjected to hydrophobic interaction chromotography which protein will bind most strongly to the resin?2)Four proteins Cytochrome C (pI=10.2) Myoglobin (pI=7.2), Hemoglobin (pI = 6.8) and Serum Albumin (pI= 4.8) were used in our gel electrophoresis lab exercise. Which protein would move toward the positive electrode? choose all that applies. Cytochrome C Myoglobin Hemoglobin Serum AlbuminYou have purified Protein 'X' and you want to know its concentration. As we learned, you can calculate concentrations by simply measuring UV280 absorbance of protein solutions. Using a UV spectrophotometer, you measured an absorbance of 0.6. Given that Protein X has an absorptivity (or extinction coefficient) of 0.2 mL•mg-cm at 280 nm, what is the concentration of purified protein solution (assume the light path is 1 cm)? -1 O A. 3 g/mL B. 3 mg/mL OC.0.2mg/mL OD.0.2 g/mL OE. 0.6 g/mL
- (a) 1 Normalized fluorescence 0.8 0.6 0.4 0.2 0 50 55 OM 0.100 M 0.200 M 0.300 M 0.500 M 1.00 M 2.00 M 60 113588 65 Temp. (°C) 70 75 80 Where is fully folded protein? • Where is fully unfolded protein? • Where is partially folded protein? • To what does SYPRO orange bind? • Why does fluorescence increase as a function of temperature? ● Define a melting temperature for a protein. • Demonstrate how an estimated melting temperature of the protein in zero molar ligand can be determined. • What is the effect of increasing the molar concentration on melting temperature for this protein? • Why is melting temperature a useful measurement to make for a protein especially if you are interested in protein aggregation?How many copies of a protein need to be present in a cell in order for it to be visible as a band on an SDS gel? Assume that you can load 100 µg of cell extract onto a gel and that you can detect 10 ng in a single band by sil ver staining the gel. The concentration of protein in cells is about 200 mg/mL, and a typical mammalian cell has a volume of about 1000 μm³ and a typical bacterium a vol ume of about 1 µm³. Given these parameters, calculate the number of copies of a 120-kd protein that would need to be present in a mammalian cell and in a bacterium in order to give a detectable band on a gel. You might try an order-of-magnitude guess before you make the calcula tions.6. Consider the following proteins to answer the questions below: Protein Size (kDa) pl ε at 280 nm 10 4 7000 50 4 14000 10 8 3000 50 8 50000 A B C C Red Colored? Yes No No No b. Describe a two-step purification procedure that could be used to purify/isolate protein A from the other proteins. In your response, describe the type of chromatography used, the pH of buffer needed, and a labeled chromatogram (include absorbances at both 280 and 400 nm). Make sure you note which "fraction/sample" is needed from the first step to proceed/use for the second step. Use another page if necessary.
- On an SDS-gel, If the distance traveled by the bromophenol blue dye is 7 cm, and the distance traveled by the protein band is 2.8 cm, the mobility of the protein is 40 4 40% 0.4Consider the following protein mixture: Protein A B C D Molecular Weight (kDa) 50 150 200 350 Affinity to Metal ion === Zn²+ === 1. Using hydrophobic interaction chromatography, the protein that will be eluted last is [Select] 2. Using affinity chromatography, the protein that will be eluted last in a Zn²+-containing column is 3. The protein with the fastest migration towards the anode in SDS-PAGE is [Select] IpH value 7 3 9 5 [Select] [Select] 4. Using a buffer solution with a pH of 4, the protein that will bind to an anion exchanger is 5. The protein that will be eluted last in a gel filtration column is [Select] 6. Using isoelectric focusing, the protein that will have a protein band nearest to the cathode (negative electrode) is [Select] % Hydrophobicity 20 45 75 55Consider the following properties of the protein components of a sample mixture as provided in the table below. Protein Molecular IpH Percentage of polar amino acid residues Weight (kDa) (%) АСЕ 200 7 20 CLU 25 65 DIA 100 10 40 НЕА 50 80
- How many copies of a protein need to be presentin a cell in order for it to be visible as a band on an SDSgel? Assume that you can load 100 μg of cell extract ontoa gel and that you can detect 10 ng in a single band by sil-ver staining the gel. The concentration of protein in cellsis about 200 mg/mL, and a typical mammalian cell has avolume of about 1000 μm3 and a typical bacterium a vol-ume of about 1 μm3. Given these parameters, calculatethe number of copies of a 120-kd protein that would needto be present in a mammalian cell and in a bacterium inorder to give a detectable band on a gel. You might try anorder-of-magnitude guess before you make the calcula-tions.Can Cells Be Separated into Their Component Fractions? How? Centrifugation is the first step in most fractionations, but it separates only components that differ greatly in size. Compare and contrast very high, high, medium, and low-speed centrifugations of supernatant mixtures. What is Chromatography? Can proteins be purified and separated through Chromatography? Explain your answer. Define the following: SDS Polyacrylamide-Gel Electrophoresis and Immunoprecipitation1. In Gel filtration chromatography, when will you stop collecting eluents if sample is not colored? 2. How does SDS-PAGE separate proteins and peptides from each other? Explain. 3. Explain the Donnan Membrane Phenomenon. Why is it important for the homeostasis of the cell?